Video Game-Playing Robot Acts More "Human" than Humans
Allison GuyComputer-controlled players in video games can usually be spotted for their repetitive, illogical or unemotional behavior. Unlike humans, non-player characters (NPCs) don't get …
Computer-controlled players in video games can usually be spotted for their repetitive, illogical or unemotional behavior. Unlike humans, non-player characters (NPCs) don't get …
Researchers at the University of California discovered that bots now excel at solving CAPTCHAs faster and more accurately than humans.
The American Chemical Society has announced a new method of producing gelatin that sounds like good news for cannibals and the canni-curious. Researchers are able to create …
Nonhuman Nonsense is a research-driven design and art studio existing somewhere between utopia and dystopia. They wonder upon our relationship with the non-human, embracing …
Imagine being 16 and studying for a job that soon won't exist. What kind of future is that? New occupations will come thanks to robotization.
' Team Human ' is a manifesto—a fiery distillation of media theorist Douglas Rushkoff’s most urgent thoughts on civilization and human nature. In one hundred lean and incisive …
It’s widely known that the world has a plastics problem. What’s less widely known is that we have a similar problem with another kind of waste: electronics
Principle number four: Humane technology should resonate with the human senses, rather than numbing them. If you're an office worker or a video game fanatic , you may spend most …
Humans and other hominids have a reputation for bringing about mass extinctions. Homo erectus has been blamed for the disappearance of many African carnivores, our ancestors …
A new theory claims it wasn't human deforestation that caused the ecological collapse of Easter Island, but something smaller and squeakier.
The greatest taxidermy in the world reveals a great deal about our changing notions of nature.
Buckle up for a new video from our favorite performance philosopher Jason Silva: To Be Human Is To Be Transhuman.
The Stock market skirt Nancy Paterson made a blue taffeta & black velvet party dress that represents the real-time stock market situation by lowering or raising its hemline. …
Remarkable infographic by pcrm.org . Via NY Times , via Consumerist.com .
What makes us human? And why do we sometimes fear artificial intelligence? And what about technological singularity - the moment in time when artificial intelligence outperforms …
NNN director Koert van Mensvoort writes a letter to humanity.
Nowadays mechanical intelligence is often chosen over that of our own human capabilities. But there was a time where our computers were still not always a match against our own …
And now for the sixth and final principle: Humane technology improves the human condition and helps people realize the dreams they have of themselves. No matter what your …
When you look through a super-telescope, you can still see the planet Earth. Once called the blue planet, she now looks red and parched. We had no choice but to abandon her… On a …
Our second principle: Humane technology revives human intuitions, in particular those we might have forgotten about. 'Conventional' technology aims to overcome our hominid …
Our bodies are microbiomes, suffering from our habit of cleanliness.
AI sure knows how to throw a banger of a dinner party. One that guests will never forget - or outlive. When New Zealand grocery store chain PAK’nSAVE introduced their new …
New technologies – from artificial intelligence to synthetic biology – are set to alter the world, the human condition, and our very being in ways that are hard to imagine. The …
The third principle of humane technology: It should take human values as a cornerstone of its development. Technology doesn't have to be expensive or electronic to be humane. …
We must be mindful about how we engage with technology: what we use it for, why, and whether it helps us or hinders us. Sometimes our tech seems to be flowing in inhumane …
Stick-on shoes, wakeup lights, bionic limbs: these are examples of humane technology. But what exactly does this mean? It can best be explained in contrast with its opposite. …
We must be mindful about how we engage with technology: what we use it for, why, and whether it helps or hinders us. Sometimes our tech seems to be flowing in inhumane directions, …
Around the world thousands of people are on organ donor waiting lists. While some of those people will receive the organ transplants they need in time, the sad reality is that …
In 1486, six years before Columbus dropped anchor in the New World, the 23-year-old Italian nobleman Giovanni Pico della Mirandola penned a passionate discourse on the unique …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
What if design began to put everything but the human first? The needs of the human not paramount to the design process, but instead the other entities that we cohabit planet earth …
There seems to be a green shift happening in Dutch Design, where the traditional vision is slowly sprouting into a newer, more refreshing one. The biodesigners are emerging from …
Octavio Paz says calls The Invention of Morel , “ without exaggeration… a perfect novel. ” According to Borges, “ to classify [it] as perfect is neither an …
Lately it seems that every movie, book and video game we see is about future apocalypses. Science articles are also painting a grim future for Earth and its inhabitants. If it’s …
Written by Kevin Kelly , published in The Technium . I claim that technology has its own agenda. What is the evidence that technology as a whole, or the technium as I call it, is …
The nature of humanity in the twenty-first century is, according to sociologist Steve Fuller, a ‘bipolar disorder’ beset with dualisms of identification such as divine/animal, …
Humans have been changing the composition of the atmosphere for years, resulting in concerns such as air pollution and extreme climate events. According to Filips Stanislavskis , …
Dutch mechanical-engineer Jarnos Smeets dreams of flying like bird. Nothing new really, many people have had this dream for ages. Yet being an engineer and all, Jarnos is seriously propelling his dream towards a reality.
Is human activity altering the planet on a scale comparable to major geological events of the past? Scientists are now considering whether to officially designate a new …
In Ngogo, Gombe and elsewhere in Africa, bands of male chimpanzees regularly make organized raids on neighboring troops and batter their enemies to death. These grim, warring …
Pair-bonding sets humans apart from our relatives. But where did it come from?
Meet Humanity beyond Race, it's Beautiful
The artificial womb is on the verge of becoming a reality, but how it will affect our culture is for us to decide.
By Karen Kaplan, Los Angeles Times , December 11, 2007 The pace of human evolution has been increasing at a stunning rate since our ancestors began spreading through Europe, Asia …
What are the characteristics of the perfect leader? The answer could be found looking at nature.
Scientists keeping a human embryo alive in lab for 13 days for the first time.
Occupying the 52nd floor of Tokyo’s Mori Tower, Mori Art Museum is internationally renowned for its visionary approach and highly original curation of contemporary art. The …
The textile industry is the second largest polluter in the world that leads to a chain reaction of nasty results: loss of biodiversity, water pollution and soil erosion are just a …
The SAVE THE HUMANS! book is now available on our web shop.
Global warming is "very likely" a human-caused problem that will last for centuries and require concerted international action to reduce its potentially devastating impacts, a …
At the turn of the millennium, miniaturized canines acquired the cherished status of living, designer handbag ornaments. These teeny tiny photogenic doggies, which had been …
The definition of the noosphere as "the sphere of human thought on earth" is woefully anthropocentric. It ignores that fact that our fellow sentient organisms have noospheres of …
Human test subjects felt empathy for dinosaur robots being cuddled or abused.
Eating meat has made us who we are today: evolved, intelligent humans, able to use a verbal language.
In 2016 a team of biologists has successfully kept a human embryo alive in the lab for 13 days, breaking the previous record of nine days.
A team of researchers are currently investigating the fusion of human brain cells with artificial intelligence. Creepy or innovative?
Thanksgiving is fake-for-real. While it's true that there was a minor harvest feast in 1621, held by English immigrants and Wampanoag Indians, the event was never celebrated …
The increasing ‘liveliness’ of machines and accessibility to the virtual world has raised questions about whether it is possible to uncouple the mind from the body in through a …
Go world champion Ke Jie has lost two games of 'Go' against Google's DeepMind AI system AlphaGo.
Interview witth TEDx on how people are technological by nature, yet how we also need humane technology to remain human, or become even more human than we are today.
Wu Tzu-ning presents a posthuman reality from genetic engineering to digital afterlife.
Due to its digital citizenship program, something interesting is happening in Estonia. In July there were more new applications for e-citizenship than newborn babies. Are we …
As you read this, a strange object that looks like a 2,000-foot floating pool noodle is drifting slowly through the central north Pacific Ocean. This object is designed to solve …
As we go about our daily activities, we may lose sight of our connections with nonhuman life. Here are three exhibitions to encourage you to step outside of your everyday and …
Humans are the only species on earth that cooks its food. Not only do we cook our food, but we usually find the flavor of cooked foods preferable to the raw version. Compare the …
Arne Hendricks thinks we can solve the ecological crisis by shrinking every human on earth to 50cm tall: http://bit.ly/sxxNr1 #powershow
Tiny houses have been heralded as a radical and creative way to address a lack of affordable housing, as well as reducing living costs and shrinking our carbon footprint. My PhD …
We call upon you, dear readers, to participate in a new publication from the Next Nature Network: SAVE THE HUMANS!.
Today there are on average there are some 8000 planes in the sky carrying at least half a million people. On average during the Stone Age there must have been less.
Read the Letter to Humanity in Morse Code.
Scientists in the UK applied for permission to create part-cow, part-human embryos for research aimed at treating diseases such as Parkinson's and Alzheimer's. The embryos created …
Principle number five: Humane technology doesn't outsource people, but instead empowers them. How healthy or humane is it to have an escalator to the gym? Humane technology should …
For our new book "Save the Human" we invite you to submit quotes that question the autonomy of mankind in the digital computer era and study the future of the independent creative spirit.
For the first time in history the world population counts more people who are too fat than too thin.
Next Thursday, February 11, the Hoxton Hotel in Amsterdam dedicates an evening to our newest publication: 'Save the Humans!'
On the occasion of the Earth Day, 22 April 2017, philosopher Koert van Mensvoort wrote his Letter to Humanity.
All too often, technology frustrates us. It forces our behavior into constrained pathways. Even more insidious, technology can knock us out of alignment with our values, goals or …
Krill, those tiny members of the ocean's planktonic community, have an importance disproportionate to their size. They are a vital food for whales, penguins and increasingly, …
Economy is ecology . At least, according to the biomimicmarketeers of the US Wachovia Bank who created this weather report like newspaper advertisement. Nowadays most people worry …
So you thought the Internet was made by and for people? Think again. A study by Incapsula , a provider of cloud-based security for web sites (mind you where this data comes from), …
The food writer Bee Wilson, author of Consider the Fork , has put forth a surprising theory about forks and teeth that has received widespread online coverage. According to …
Robots are coming to replace humans at work, are they a real threat to the world’s unemployed?
Scientists have been trying to develop GM pigs that could be used to solve the shortage of organs for transplant patients.
Is human cloning here? Chinese scientist is ready to clone people at his ‘replication factory’.
The Italian government just launched a campaign to raise awareness for falling birthrates and encourage family planning.
This question is an excerpt from the Pyramid of Technology toolkit In the late nineties, the Tamagotchi egg was released. A small egg-shaped device that contained a digital …
Written by Debbie Mollenhagen PART 1: FROM LINEAR TO CIRCULAR Designer living has become designing life. I often ask myself: did it taste like the real thing? But when I open my …
I never expected anthropomorphobia to be evoked by a fish! This hybrid species fish was born between a carp and a leather carp in the pond of a personal house in Chongju. Each of …
The human body as an instrument is a cool example of how culture and nature are merging. Calvin Harris used a giant human synthesizer to perform his single. The material used is …
The economic system and profit motive has been a driving force that steers and even dictates social change. Investors and stockbrokers have been a major influence to these social …
A musical robot able to improvise a jazz solo in response to an actual person performing jazz.
Over the past decade scientists have tried to get technology surfaces to be as sensitive as our skin, especially as our fingertips. Human tact is a very sophisticate interface …
In 16th and 17th centuries, some medical theory believed that a miniature human body can be produced in a flask by an alchemist.
In 2015, a group of scientists from the University of Michigan claimed to have made the world's first artificial placenta.
Artist Lauren McCarthy launched a project called LAUREN in which she embodies a eponymous human smart home assistant.
What will the human race look like in 1, 2, 3, 4 million years? Will it be one human race? Will there be a human race? Impressions of future scenario's must come from scientists, …
Nissan’s Engineers Are Creepily Trying To Replicate Human Skin
Historian Yuval Noah Harari takes us on a journey through the whole human history.
Human fitness has decreased so significantly that even the strongest of us would consider ancient men to have a supernatural force.
De Motu is an interactive music app that let you experience your body through music and influence the sound with your own body.
Gene editing is advancing at a faster pace than most of us can keep up with. One significant recent announcement was gene editing tool CRISPR’s application to non-genetic diseases …
Toregem Biopharma designed an antibody drug that can possibly regenerate teeth using the body's own tissues.
Going to the zoo is a favorite summer past-time. Visitors to the Schönbrunn Zoo in Vienna will see lots of animals in recreated ‘natural’ habitats. Except this summer, along with …
For a while now printer ink is probably the most expensive liquid per litre on earth. Still we need our images so badly that we accept this fact. The Human Printer manages to make …
In Holland people go crazy for soccer, especially now that the national team has reached the World Cup final. We gather everything that's orange – our shirt color – as the …
All living creates produce light by default, so do humans . Now researchers from US, China, Korea and Singapore collaborated have collaborated in order to create ultra-thin …
Alveoli in human lungs serve as the inspiration for designing better, stronger ways of storing compressed natural gas.
British research group created anew scanning technique permits to obtain 3D images and detect wavelengths that our visual system is not able to see.
Workers are completely controlled by algorithms in Amazon's fulfillment center
Just a project for now, but a far more creative way to deal with unsightly public works than tree-shaped antennas.
In suburbia, we hope to get away from it all. Unfortunately, everyone else has the same idea. Happy Thanksgiving to our American readers!
Driving long distances without a passenger can be lonely. If you’ve ever done it, you might have wished for a companion to talk to – someone emotionally intelligent who can …
Designer Arianna Pezzano creates prosthetic nipples using keratine coming from the hair that cancer patients lose during chemotherapy.
Imagine a graveyard without tombstones, instead there are growing trees that contain genetic material of the deceased people burried there. Biopresence creates Human DNA trees by …
Think of this sonic vibe-technology inside any MP3 player ;)
Eric Hoffer (1902-1983) You dehumanize a man as much by returning him to nature - by making him one with rocks, vegetation, and animals - as by turning him into a machine. Both …
Artist Nadine Jarvis fabricates pencils from carbon left over of cremated humans -- it's part of a larger "research project into post mortem." She notes that "240 pencils can be …
Starting next spring, a complete human-genome sequence can be ordered the Californian startup Complete Genomics for just $5,000, Techreview reports. Currently sequencing still …
Anthropomorphobic object of the week. Created by Sarah Hatch .
After being denied permission to reproduce the famed Little Mermaid statue from Copenhagen, the authorities of Vancouver decided to go for something more realistic.
Just when you thought the Second Life hype was long gone, meet Ukrainian body artist Valerie Lukyanova who aims to turn Second Life into First Life. They call her the Human …
Will writing software eventually replace journalists?
What does Barbie look like when she has the proportions of a normal 19-year-old?
All humans on Earth put together are not enough to fill the Grand Canyon. We are so small yet so present.
"It's time to recognize the Internet as a basic human right" its inventor Sir Tim Berners-Lee has said.
Three minutes in the mind of Juan Enriquez, director of Synthetic Genomics.
A new biotech startup seeks to hack our cells to use solar energy instead of carbon and oxygen.
To thread the uncanny valley is a conscious choice for many artists and enthusiasts, as a means to evoke, through their work, powerful emotions, thoughts and everything in between.
AAAGCTCGGTTATAACCATCATTTTCCGAAGACCAGCTACAGCTCACTGCAATTT Gene expression technology is used to evaluate changes in genes being visualised in normal and transformed cells. Changes …
This peculiar, half-human creature could be your cousin. No really; it is a sculpture by Patricia Piccinini entitled The Young Family , which, in turn, is part of a larger …
Modern society seems to have transformed human nature into a pathology. Our emotions are controlled by drugs. We are forced to operate within a narrow bandwith of what are …
Fleshmap touch investigates the collective perception of erogenous zones. Hundreds of people ranked how good it would feel to touch or be touched by a lover in different points of …
Much attention has recently been devoted to 'gay' animals. It's not the fact that many species have enthusiastic homosexual lives that should be surprising – there are convincing …
Black wolves should probably not exist. The same species as their gray relatives, these wolves have a genetic mutation that causes them to produces excess melanin, a pigment …
As a gamer, I come across many visions of possible futures. But this trailer from the upcoming video game Deus Ex: Human Revolution , the third part in the Deus Ex series shocked …
A smart campaign by Ogilvy Paris for WNF shows that also the ‘non-cute’ animals need our help. via Fubiz
Part 10 in the 11 part series Anthropomorphism and Design . The hidden danger with interactive products is that they will become so good at fulfilling our needs that they start to …
Researchers in the US have been shocked to discover a beluga whale whose vocalisations were remarkably close to human speech.
In combining the classic feeling of handling a book with the interactivity of the computer, Waldek W?grzyn of the Academy of Fine Arts in Katowice, Poland, has created a new human-computer interface.
Dolphins in Port Adelaide, Australia, have been observed performing a remarkable trick : tail-walking, a trait so rare it has only been seen in the wild one other time. More …
Artist Maja Smrekar modified yeast with her own DNA to produce human lactic acid.
The Human Hamster Wheel Desk is the latest result of workspace evolution. Office work has domesticated us!
If we'll ever get to go to Mars as tourists , we wouldn't get lost. Ordnance Survey , the official British mapping agency, recently released a new detailed map of the Red Planet. …
Lyrebird is an AI model capable of synthesizing anyone’s voice from just a one-minute audio sample.
Under the title Human Nature, designing the equilibrium, eleven designers will answer questions about a future in which Humankind and Nature enter into a new relationship. An …
A tribute to the virtual world boomeranging back to the physical world by Mega64 . Or do you rather prefer the corny japanese gameshow version? Via Engadget ,
Why not use the human body to grow products for the medical industry? The designer Michael Burton envisions Future Farm where the body is used as a farm to cultivate clinical and …
Our peculiar image of the week was created by artist Levi van Veluw , who reinvents the classical fine art of landscape painting, by moving from the traditional 'oil on canvas' to …
Within our society, imitation and simulation are typically seen as inferior symbols of a distorted mediated culture – think of fake Rolexes, plastic Christmas trees, silicone …
Whereas lizards have the extraordinary ability to regenerate lost limbs – meaning that if the lizard loses a limb through conflict with a predator, it will grow back – people have …
Food technology in the overdrive: Pork molded in the shape of a piglet.
Clothing giant H&M no longer uses real humans in its online catalog. The company has admitted that it pastes real models' heads on computer-generated bodies. At least there's …
Part 8 of the 11 part series Anthropomorphism and Design . Anthropomorphic products blur the boundaries between products and people. Ethical norms for people don’t usually apply …
Warning, this video on the impact of automation on human labor might cause you to re-plot you professional career.
French performance artist hatches 10 hen's eggs in Palais de Tokyo.
New media technology from South Korea: a gigantic human display compiled from supporters cheering their soccer teams . One pixel per supporter. See also: Skyscreen , A4 e-paper .
Introducing the brand new, hand made, eco friendly, sweat absorbing, natural, healthy and most of all fashionable bamboo keyboard. It seems bamboo isn’t just for pandas anymore. …
Cake or death? Cake! The Slice cake is a (vegetarian) vision of the forms lab-grown meat may take in the future.
The personal touch of pen and ink VERSUS the efficiency and productivity of digital word processors.
Buckle up for a cinematic espresso shot from performance philosopher and NNN ambassador Jason Silva.
This unpractical yet not less pretty anthropomorphic furniture piece was created by photographer David Blazques . We are clueless on whether it is in permanent use, yet it serves …
Read Nicholas Carr's essay on the transhumanist dream of having wings.
I remember the smoke the most. That pungent smell permeating the camps of tribal people. Everything they touch is infused with the lingering perfume of smoke – their food, …
When I was a kid, my parents took me to the beach every summer. We’d swim in the ocean and play on our inflatable raft in the surf. When the tide was low, I’d build a sand castle …
In 1961, the name of Marshall McLuhan was unknown to everyone but his English students at the University of Toronto – and a coterie of academic admirers who followed his abstruse …
Are you familiar with the affliction? Anthropomorphobia is the fear of recognizing human characteristics in non-human objects. The term is a hybrid of two Greek-derived words: …
With the invention of the radio antenna in the late 19th century, we became a different species: Introducing the human insect. A species, able to communicate across oceans using …
When techno–optimist and fellow at the Hybrid Reality Institute , Jason Silva, meets with Richard Doyle, author of Darwin's Pharmacy: Sex, Plants and the Evolution of the …
We had the honor of hosting Bruce Sterling in our Next Nature Network headquarters to talk to him about the concept of the convergence of humans and machines.
For years, normality has been stretched nearly to its breaking point, a rope pulled tighter and tighter, waiting for a nip of the black swan’s beak to snap it in two. Now that the …
Nature has always been a source of inspiration for many artists and designers, yet the urgency to connect to nature is more pressing than ever. Environmental issues such as …
There’s no place on earth untouched by human activity: This was clear as Lucas Foglia whizzed across the vast, white expanse of Alaska's Juneau Ice Field last summer. He was …
Speculative designer Agi Haines' work focuses on (re)designing the human body, and speculates upon future scenarios.
What does the supermarket of the future look like? The Embassy of Food at Dutch Design week.
Sleep and dream like a koala, relax under biodiversity and feel the meditative effect of artificial wildlife.
If Neanderthals ever walk the earth again, the primordial ooze from which they will rise is an emulsion of oil, water, and DNA capture beads engineered in the laboratory of 454 …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
The idea of colonizing Mars has become the big speculative future of humanity on Earth. But, artist Alexandra Daisy Ginsberg has radically different ideas to contribute to the …
A psychiatrist argues that beer gave us civilization - but do intoxicants play a deeper evolutionary role than that?
Floris Kayak discusses online hoaxes and the future of technology.
Bioprinter creates bespoke lab-grown body parts for transplant.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
The skies in Beijing turned orange recently, thanks to what was widely reported as a massive sandstorm . The problem, at least in terms of public health, is that it was not …
What if we would use the idea of symbiosis as the basis for the next period of Earth’s history?
The connection we share through the Internet has laid the foundation for a whole new digital infrastructure, in which blockchain technology is heralded by many believers for being …
Did you know that some Dutch people are so addicted to their devices that they'd rather give up sex, vacations, or even a finger than their phone?
Reduce, reuse, recycle. We know the drill. But how do we cope with a junkyard in space?
A must-read to the Next Nature fan: Catching Fire: How Cooking Made Us Human (2009). Written by British primatologist Richard Wrangham, the author shares his hypothesis that …
From icy tundras to billowing clouds, the colour white crops up repeatedly in our planet’s palette. This colour provides a natural way for light from the sun to reflect back from …
A stunning pre-history of the anthropocene
Is the use of personal devices becoming a replacement for the spectrum of emotions that make us all humans?
Augment your physiology. Enhance your prospects. From neuro-electronics, to robotic-prosthetics and mind-altering pharmaceuticals.
Humanity has for a long time considered itself the most important species on the planet. We are quite happy to share the world with other species, but we think we know who's in …
Nature provided humans with an extensive set of sensory modalities, allowing our brain to constantly gather sundry inputs from the outer world. These sensory inputs help us …
Surrounded by greyness and with the air around you having a dusty, burnt taste; for a long time this is what it has been like to live in many of the world’s highly polluted …
On King's Day the water board of Amsterdam wants to collect urine and use it as fertilizer.
You are what you eat; a quite common message in the midst of our self-growth society. We have to eat well to become the best version of ourselves - more productive, healthier …
In 1953, a Harvard psychologist thought he discovered pleasure – accidentally – within the cranium of a rat. With an electrode inserted into a specific area of its brain, the rat …
We have witnessed significant progresses in the field of real-time translation, and this new wearable translator, called ili, sums up perfectly this essence.
Madrid's new plans to fight rising temperatures and high pollution rates investing on green urban areas.
Nigel Gifford is developing a drone that will be relatively inexpensive, disposable and edible.
How technology becomes nature in seven steps
Take a bite from this pear and I'll spare you all the default connotations with the apple of eden. Source photo by Pablo Montanez . See also Modernistic Watermelon , Ferrari …
The ultimate personal hygiene product, feces odor tablets, is another Japanese innovation sold by the Takano Yori Beauty Clinic . These pills promise to make your excrement …
Amazon's Echo smart speaker may have witnessed a murder. But will it talk?
Researchers tested 'Fiji Water' against ordinary tap water. What they found is kind of shocking.
The simulacrum is never that which conceals the truth--it is the truth which conceals that there is none. The simulacrum is true. -Ecclesiastes If we were able to take as the …
The way we currently build is not sustainable. We will have to develop a sustainable living environment that matches our human needs, intuitions and potential.
Previously, experiences of time emerged from nature as given – offering seasons, the rhythm of humans, plants and animals. Nowadays, people integrate nature-time, body-time, inner-time, clock-time, and global 24/7 systems-time. Human beings, in past, current and next natures, have to deal with emergence and design of time in order to survive.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here? Get in touch and …
We recently spoke to Ilari Laamanen, to peel the outcrops of Momemtum9, and unveil the overlapping themes to the next nature philosophy.
Imagine if everyone spoke a language that you don’t understand. It’s not a foreign language–it’s been spoken around you since the day you were born–but where as everyone else …
Marxist philosopher Slavoj Žižek discusses the 'naturalization' of capitalism and how ecology became a new field of capitalist investment. He also argues that the ultimate …
Pleun van Dijk is a speculative artist/designer who investigates the intimate relationship between human and technology.
Mars ain’t the kind of place to raise your kids, laments the Rocket Man in Elton John’s timeless classic. In fact, it’s cold as hell. But that doesn’t seem to worry a new …
For the Venezuelan Magazine Platanoverde , Gabriela Valdivieso y Lope Gutiarrez-Ruiz interviewed artist/scientist Koert van Mensvoort and discussed some of the idea's behind Next …
Some of our greatest cultural and technological achievements took place between 1945 and 1971. Why has progress stalled?
In configuring our next nature, artists and scientists explore new languages that move beyond the Anthropocene - the era of human beings. These semantics would bridge the gap …
The introductory essay from the Yes, Naturally book - available in our store!
The first time I explained biomimicry to a stranger was not in a talk or a workshop but in a big-box bookstore just after Biomimicry: Innovation Inspired by Nature had come out. I …
So you’re triggered by our call for products and now you’re considering to send in one, two or maybe three of your brilliant products for the Nano Supermarket? Good. Or – and this …
Do humans exist merely to make money and use resources? Vandana Shiva believes humans have a higher purpose.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Rachel Armstrong discusses living buildings, Venice's foundations, millennial nature and how to improve our future.
We have entered the Anthropocene epoch, in which humanity and its instrumentalities are the most potent and influential geological force.
Technology is nestling itself within us and between us, has knowledge about us and can act just like us.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Today we hold the ability to gather a lot of knowledge, thanks to science. We are able to watch, analyze, manipulate and change matter to the nano-level. This makes it tempting to …
The next step is to embrace and celebrate how cultural artifacts are escaping control, becoming autonomous, and forming the “next nature”.
At the edge of the woods along the motorway near the Dutch town of Bloemendaal, there stands a mobile telephone mast disguised as a pine tree. This mast is not nature: at best, it …
We live in a world in which we control the biology of a tomato at such precision, you could think of it as a product of technology, instead of a product of nature. Think about it, …
If we want to bring down global CO2 emissions to zero, we will need technological innovation and massive infrastructure projects.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
The first essay ever written on Next Nature, published in Next Nature Pocket and in Entry Paradise, New Design Worlds . ( download pdf ) (German version: Erkundungen im Nächste …
The Moon Gallery aims to set up the first permanent museum on the Moon. Soon launching to the International Space Station, full of ideas worth sending to the Moon. The gallery is …
Energy policy blah blah blah, life cycle analysis blah blah blah, energy return on energy invested, peak oil, carbon footprint, renewables, hydro, nuclear, blah blah blah blah …
Interview with Mike Thompson and Susana Cámara Leret.
'Big History' is a multidisciplinary study that seeks to put the human story into the context of a 13.8 billion-year story from the Big Bang to now.
Like it or loathe it, the robot revolution is now well underway and the futures described by writers such as Isaac Asimov , Frederik Pohl and Philip K. Dick are fast turning from …
John Zerzan, published in Green Anarchy issue #24 - Spring/Summer 2007 The rapidly mounting toll of modern life is worse than we could have imagined. A metamorphosis rushes …
An interviewer once asked Pablo Picasso why he paints such strange pictures instead of painting things the way they are. Picasso asks the man what he means. The man then takes out …
This project - the Next Nature Network - is about Nature's brand image. One might surmise that "Nature," being 100 percent all-natural, can't have any brand image. The facts …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
Let’s talk about the most controversial of "m words"—monogamy. And let’s have this conversation with in mind its prehistoric origins. Our modern picture of prehistoric societies …
In this essay, anti-civilization, anarchist philosopher John Zerzan critiques the concept of 'next nature.' He argues that rather than freeing us, our self-domestication through …
Uli Westphal's Seed Series is an ongoing attempt to document the seeds of all edible plants, one seed at a time.
Dutch fashion designer specialized in wearable technology, Pauline van Dongen researches the human body in relation to its surroundings.
There it is. A hefty hen, with its head up high and its beak out. And a gigantic VR headset over its beady little eyes. What does this battery hen see? ‘An experience of a free …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here? Get in touch and …
Digital and genetic techniques increasingly influence life. Our belief in progress through technology stands in the way of a moral debate on this development. By Rinie van Est We …
Since Darwin we tend to look at the biological world exclusively in economical terms. The idea that monkey's, frogs, or even ants do more than simply propagate, doesn't find much acceptance among scientists. And yet, even crayfishes at times seem to displace objects just for fun.
From nutrients within an organism, to organisms within collectives, to populations within a territory and so on - nature offers models on how to deal with highly complex systems.
We humans are changing. We have become so intertwined with what we have created that we are no longer separate from it. We have outgrown the distinction between the natural and the artificial. We are what we make.
Since the early days of the net, the electronic pastoral has lent itself to all sorts of dubious agendas pushed by science, the military and even libertarian tendencies. In the …
Invasive species become the animal symbols for a man-made world.
Read Benjamin Aldes Wurgaft's essay on judaism in relation to the production of laboratory-grown meat.
Dutch experience designer Leanne Wijnsma designs for the human instinct and puts the sense of smell back to where it belongs, as modern hazards have shifted to the digital realm.
Ten books that continue to inspire the next nature philosophy—gathered for you to read this summer.
The coverstory of Next Nature Magazine investigates how the rise of virtual influencers on social media reveals a superorganism.
In vitro meat has the capacity to transform meat production as we know it, introducing an entirely new way of thinking about and interacting with food.
Interview with Liam Young on his work in speculative architecture, the future, and our role in nature as humans.
A large-scale asian food market serving in vitro meat, a transatlantic expo on the future of nature and a travelling exhibition that explores our relationship with AI. These five …
For many people, the most distressing part of the coronavirus pandemic is the idea of social isolation. If we get ill, we quarantine ourselves for the protection of others. But …
Then, as now, one person could literally change the course of history, with nothing more than an idea.
Demand for life-saving organ transplantation is at an all-time high. In 2021, a record 41,000-plus organ transplants were performed in the U.S., with top numbers for kidney, liver …
Make no mistake, you're not looking at the latest Barbie line: These are the The Pussycat Dolls. Formerly an LA stripper show burlesque show, now upgraded to be pop music …
Our bodies are maps of our ancestor's social lives. We evolved, physically and behaviorally, in incredibly complex social groups. Such intense sociability may have favored the …
Are we alone in the universe? The famous Seti (Search for Extraterrestrial Intelligence) programme has been trying to answer this question since 1959. American astronomer Carl …
How will we stay healthy in the future? Can we utilize the power of design to move towards a more healthy society?
Some 10,000 years ago humans began to domesticate plants and animals. The birth of agriculture, one of the earliest technologies available.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Meet the teledildonics, an ingenious species of bi-directionally controlled sextoys from the future, available today. These touch emulating vibrators find each other on social sex …
Visual artist Heleen Blanken explores the complex relationship between people, nature and technology.
The Made and the Born: Neo-Biological civillization, written by Kevin Kelly, excerpt from Out of Control : The New Biology of Machines, Social Systems and the Economic World, …
Is the evolution of the single bladed razor into an exorbitant five–bladed vibrating gizmo the outcome of human needs, or is there another force in play? Say hello to Razorius …
Every time we eat a piece of food, we take a bite out of the world. All these small bites tell a dozen stories. A carton of eggs presents the story of contented hens, a bottle of …
Many people welcome in vitro meat because of what it may mean for animals. Even though they often find the idea strange, the promise for animals is widely felt as a source of hope.
We recently talk to Nadine Bongaerts about the role and impact of synthetic biology, the gap between biosciences and society and the importance of communication to overcome the fear of new technologies.
Over time, our bodies, our food and our environment have become more and more subject to design. As designers, we hold the responsibility and have the unique chance to envision …
The history of art through the ages reveals a constancy that, by conscious or unconscious applications, provides us with an omnipresent correlation dealing with the …
We humans simply feel more comfortable with technological change when it comes in a familiar form that refers to an existing and accepted object, habit, value, tradition or intuition.
Volume magazine interviews Next Nature founder Koert van Mensvoort.
Writing is recognised as one of mankind’s foremost inventions and the mechanization of writing is one of these developments that typify what is commonly regarded as the work of …
Biotechnology is nearly as old as humanity itself. The food you eat and the pets you love? You can thank our ancestors for kickstarting the agricultural revolution, using …
Last month I had the opportunity to immerse myself in Tokyo’s newly opened digital art landscape, the Mori Digital Art Museum. The museum stands out for it enables virtual …
Last week, the gene editing world was hit by news the equivalent of a nuclear bomb. In a video on YouTube , Dr. Jiankui He at Southern University of Science and Technology in …
It’s common consensus in the tech industry that the days of cars as we know them—powered by gas, driven by humans, and individually owned by all who want and can afford one—are …
For thousands of years people used oil lamps and candles to illuminate their homes during the hours of darkness. Neither produced much light and both were inconvenient in use as …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
What does the merge of bodies and technology mean for the human? For cyborg Kai Landre, cybernetic extensions become body parts and not technology. Kai began his transition to a …
During the event The Biosphere Code, Stockholm University researcher Victor Galaz and colleagues outlined a manifesto for algorithms in the environment.
On June 17th a NNN Fellow Day was organized to explore the future project: Next Senses.
What do in-vitro human skin, spider silk and cow manure have in common? They are all unlikely materials that can cloth, protect and inspire humans, as realized by award-winning …
Meet Pirjo Kääriäinen, professor of design driven fibre innovation at Aalto University, Finland. Kääriäinen founded CHEMARTS —a collaborative program at the university that brings …
Have you ever gone a day without water? Most likely you have experienced low energy levels or fatigue after a few couple of hours. Water gives us energy. More than that, water is …
Today we cannot meet, touch or hug our loved ones. And while we all like the feeling of the touch of another human being, physical contact does not just feel nice, it is crucial …
Technology is not neutral; the same tech might empower some and disempower others. It is time to check our Technoprivilege, argues author Hendrik-Jan Grievink.
Written by Werner Lippert & Peter Wippermann, Curators of the Entryparadise exhibition (26/8 until 3/12, 2006, at Kohlenwäsche, Zollverein) Design is about to undergo a …
Traditionally, technology is seen as a force that diminishes our instincts and puts us at a distance of nature. Increasingly however, we realize technology can also energize and …
Steven Levy writes in Wired on the unexpected turn of the Artificial Intelligence revolution: rather than whole artificial minds, it consists of a rich bestiary of digital fauna, …
The Singularity , as popularized by Ray Kurtzweil, refers to a near term, theoretical time when machine intelligence greatly surpasses our own. At this point we will experience a …
An interview about the history and promises of synthetic biology, and the problem with the word "nature".
Ever notice how ant colonies so successfully explore and exploit resources in the world … to find food at 4th of July picnics, for example? You may find it annoying. But as an …
At Home in the Lab with Mark Post, Father of the In Vitro Hamburger. Interview from The In Vitro Meat Cookbook
Interview with Govert Flint, designer, architect and self-taught artist.
How can we design a cryptocurrency for the better of humanity and ecology? In this last chapter of the crypto deep dive series , we will dissect two kinds of blockchain …
Right now, somewhere in a laboratory in California, the Netherlands or Japan, a technician is taking a few thousand skeletal muscle cells from a living animal, and placing them in …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
The field of biofabrication is still new to most people. As founder and CEO of Biofabricate, Suzanne Lee shared with us this exciting online event series Creatives in Biotech . If …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Next Senses explores the unchartered territory of how we could experience the world with technology
Picture this: it's 40,000 years ago, and you are an early Homo sapiens. You are standing on the savanna. Look around you. What do you see? No billboards, no traffic signs, no …
In 2009 the Initiative for Science, Society and Policy coined the phrase ‘living technology’ [1] to draw attention to a group of emerging technologies that are useful because they …
Joyce Hwang discusses the challenges for designers, and gains for citizens, of living in a truly biosynthetic city.
We talked with Bas Haring to discuss the conception, image and will of the robot. Read our conversation with him and update your ideas about robots.
As if stand-alone technologies weren’t advancing fast enough, we’re in age where we must study the intersection points of these technologies. How is what’s happening in robotics …
A team of German researchers published a study earlier this week indicating people can be duped into leaving a robot turned on just because it “asks” them to. The …
Is social media ruining the world? Dramatic political polarization. Rising anxiety and depression. An uptick in teen suicide rates. Misinformation that spreads like wildfire. The …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
The world is alight with algae fever. In this age of deep ecological design aspirations, the range of speculative design projects based on algae technology is growing. Algae are …
An interview with Daisy Ginsberg, artist and synthetic biologist.
One of the arguments that environmentalists use against factory farming and burning fossil fuels is that these activities are "unnatural" or that they "go against nature." But …
Nowadays humans suffer from diseases that didn't exist in the past, a trend that will probably continue into the future. A wide range of new disorders, especially related to the …
We asked Shubhendu Sharm, our first ECO coin award nominee about his method, business and hopes for the future.
The local fishermen looked on skeptically. From the deck of a small motorboat, scuba divers grabbed odd chunks of ceramic – which could be described as rocky brains stuck on …
Growing meat artificially, instead of within an animal, may soon be an available reality. Meet one of the pioneering developers of this product of the future: Aleph Farms. With …
The oldest known serious candidate forerunner for the bicycle is the ‘running machine’ built by the German Baron Karl von Drais. His two-wheeled machine became known as the …
The idea that AI can compose electronic music may sound a little off to people. It raises essential questions about creativity as a product exclusive to humans: can an AI be …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
A report from 2021 from the National Academies of Sciences, Engineering and Medicine tackles a controversial question : Is solar geoengineering – an approach designed to cool the …
Why memes might be the next tool to make sense of on our increasingly hybrid virtual and physical environment.
Have you heard the buzz on virtual money in online games? Some years ago the first virtual millionaire was announced, yet there have also been reports on people being practically …
Manko sighed. Nada: 'Did you like it?' Manko: 'I have to admit that if this is the starter, I'm not sure I'll survive the main course.' Everyone at the table laughed. Manko: 'Let …
The sublime is an aesthetic concept of 'the exalted,' of beauty that is grand and dangerous. Through 17th and 18th century European intellectual tradition, the sublime became …
We recently talked with Suzanne Lee about the textile industry and technology, growing leather in the lab, and the use of new alternative materials in the future of fashion.
Dystopian future scenarios filled with evil robots are everywhere. We are afraid of robots treating us badly, but what will happen if it'll be the other way around? According to …
We recently handed this year’s ECO Coin Award to Dutch designer Dave Hakkens, founder of the Precious Plastic movement. With his open sourced recycling machines, he provides people around the world the knowledge to start recycling plastic locally.
Robots are getting stronger and smarter every day. They are taking over our whole lives. How long will I have my job before a robot steals it?
As modern humans, we are out of balance with our natural environment. With use of technology, we try to prolong our human lifespan and create materials that live longer than we …
Up to half of the world’s sandy beaches are at risk of disappearing by the end of this century if no action is taken to limit greenhouse gas emissions. That’s according to a new …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
Imagine we would have an alternative monetary currency for environmental value. Would the rain forest still be destroyed if there existed an ECO–currency to express its value and …
A Dutch artist designs a Utopian eco-socialist online society.
Before we can decide if we will ever be willing to eat in-vitro, we need to explore the food culture it will bring us.
Sophia the Humanoid, a human-like robot in appearance and mannerisms, was granted citizenship by Saudi Arabia and became the first robot with citizenship.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
Patricia Piccinini is an artist interested in the relationship between humans and non-humans, the natural and the artificial, science and storytelling. Working with silicone, …
The Sun is the most important source of energy for sustaining life on Earth, but it gives us a lot more than just light and heat. It also gives us solar storms.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
William Eliot designs chairs while collaborating with mealworms.
Imagine a place called Reprodutopia. How would such a place look like?
In conversation with film director Joshua Ashish Dawson about the future of wellness, climate anxiety and healthy cynicism India-born, Los Angeles-based film director Joshua …
Mark Weiser (originally written for ACM Interactions ). What is the metaphor for the computer of the future? The intelligent agent? The television (multimedia)? The 3-D graphics …
There is a domain of creatures that diffusively encircles an entire planet. There are so many of them that they occupy every conceivable ecological niche. Yet, despite their …
Like we did to old nature before, we must now cultivate our technological environment.
Lab grown meat is part of the trajectory that agricultural technology is already following.
Would you like a dog snout, cat eyes or fluffy bunny ears? The choice is yours. Virtual selfie filters have become a widespread phenomenon on social media platforms such as …
Globally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …
Designers face an unprecedented urgency to alter their methods and reprioritize their goals to address the accelerating degradation of the environment. This new …
Matilde Boelhouwer is a designer whose work speculates between art, design, science, biology and food. Matilde shapes this obligation into a studio which mainly focuses on the …
Just because you can doesn’t mean you should – real-world genetic engineers can learn from the cautionary tale. “ Jurassic World: Dominion ” is hyperbolic Hollywood entertainment …
Sometimes a festival can be so much more. Tapping into arts, design, and electronic and experimental music festival, Sónar Lisboa (8-10 April) is one for the body and for the …
People in the world’s developed nations live in a post-industrial era, working mainly in service or knowledge industries. Manufacturers increasingly rely on sensors, robots, …
AI language model ChatGPT has hit the mainstream last year when it became widely accessible to everyone. Next to doing our (home)work, it became also a D&D Dungeon Master , …
Designer Govert Flint proposes a new office concept, entirely based on movement and play.
Douglas Coupland is a writer and artist based in Vancouver. For the canadian newspaper Globe and Mail, he wrote The ‘radical pessimist's guide to the next 10 years’ a dystopian …
All buildings today have something in common: They are made using Victorian technologies. This involves blueprints, industrial manufacturing and construction using teams of …
Intentionality separates culture from nature. A dog is intentional, a fox is not; a park is intentional, a forest is not. Since trash, ruined buildings, and automated computer …
The protozoa Toxoplasma gondii makes an unobtrusive home in nearly every warm-blooded species, but it's prolific life is limited: Toxo can only reproduce in cat stomachs. The …
Blue is a beautiful color, but its sound is simply irresistible. It is the song of the unhappy and the depressed. It is a sound that touches people. It was also the sound of a …
Hendriks’s activity explores the positive transformative power of creative impulses and the importance of fundamental free scientific research.
On the aftermath of such a historic day for Britain and the EU, it's easy to get swayed into the polarities of political discourse, particularly on social media and the Internet, where things heat up and move fast. The results of the referendum have just come out, and the Internet is already burning with tension. This is called "climate change" - just not the one you are used to hear about.
Scientists developed a procedure to repair your heart with a spinach leaf.
The phone call was as unexpected as the American accent at the other end of the line. And when she hung up a few moments later, Ira van Eelen had to stop to catch her breath. More …
A gadget called HumanCharger promises "the sun in your pocket" to give you energy, by beaming light through your ears.
A rosy-cheeked kid learns her first words, cries when her babysitter leaves, smiles when she’s happy, but she’s not real. BabyX is an AI research-in-progress by a company named Soul Machines.
Virtual reality is already becoming a part of the conversation surrounding social media. Will it become the next popular social network?
Dear Louise Brown, On behalf of the future I would like to congratulate you on your birthday. It has been 40 years that you where born into this world on July 25th 1978, …
Don’t be surprised when you catch a human face on a screen strolling through the Van Abbe museum for contemporary art in Eindhoven, as these are Europe’s very first robotic …
"To understand why a product is the way it is today, you need to learn about its evolutionary background." Meet Huub Ehlhardt, an engineer with a PhD in product design . Huub …
There was a time when flipping the switch, and seeing a glass bulb light up, was magical to anyone in the world. Today, the presence of a light switch in a room, is something …
Sex is one of the most powerful, fundamental human drives. It’s caused wars, and built and destroyed kingdoms. It occupies a significant percentage of most people’s thoughts. As …
Humans have been manipulating living things for thousands of years. Examples of early biotechnologies include domesticating plants and animals and then selectively breeding them …
During the Antarctic summer, thousands of mesmerising blue lakes form around the edges of the continent’s ice sheet, as warmer temperatures cause snow and ice to melt and collect …
Every day brings fresh and ever more alarming news about the state of the global environment. To speak of mere “climate change” is inadequate now, for we are in a “ climate …
For the past 25 years, I’ve studied everything from baboon cooperation in Ethiopia and orca whale innovation in the Bering Sea, to the Argentine ant invasion in my kitchen, and my …
The virus is forcing all of us to sit at home. While we are allowed to have social contact—albeit at an appropriate distance, intimate contact is hard to find. How to cope with …
At this moment in time, many people are staying at home in order to flatten the curve . It is times like these that we realize how vital technology is to us and our societies. It …
It’s been over a decade since artificial retinas first began helping the blind see. But for many people, whose blindness originates beyond the retina, the technology falls short. …
Imagine this: you wake up on a lazy Sunday morning, trudging your way to the fridge only to be welcomed with the smell of something rotting. Did the meat expire sooner than …
If we could extend our senses in order to perceive the planet in a deeper way, would our understanding and our behavior towards it be different? We caught up with cyborg …
We now live in a world where plastics are becoming a part of our marine ecosystems. As a result, we strive hard to clean the plastics from our oceans. Dr. Max Liboiron ( Michif …
Climate change will transform how we live, but these tech and policy experts see reason for optimism
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
The idea of altering your body for aesthetic purposes is still somewhat frowned upon today. But more than because the very idea of improving yourself, this is about its …
Artist Arne Hendriks gave a lustrous talk on the possibilities of downsizing humanity to better fit the earth.
The same way Einstein assumes the speed of light to be a constant of reference for his Theory of Relativity, the philosophy of biomimicry assumes Nature as a constant of reference …
From chef, to nurse, and also lover. Get ready, a new generation of robots is going to invade our lives!
Meet Amelia, the first robot to work along with human coworkers in a council job.
It's getting difficult to discern what's technology and what's not.With wearable technology becoming more and more integrated into society, our lives become infused with more technology.
In our ongoing battle against climate change, it's hard to transcend from our human position and ‘think’ like nature. Given, nature doesn't think the way humans do, but it does …
Smiling broadly and rattling with enthusiasm, the 33-year-old Rylana Doesburg shows off a QR-code on her phone: an angular pattern of black and white squares. “Thanks to this …
Agriculture may be one of the oldest of our technologies. Over time it has developed, changed, revolutionized, industrialized - or simply put, it has evolved . Today’s farms are …
It's not an easy task to define the practice of designer Jasna Rok . Fashtech pioneer? Radical innovator? Visionary designer? ‘All of the above’ seems only appropriate. In fact, …
Australian regulators will soon be faced with a challenge: can animal flesh produced in a lab be called meat? Amid reports that lab-grown meat could be on sale this year, the US …
Conventional wisdom says that you can’t replace the human touch in terms of medical care, but in our rapidly changing technological environment, it appears that this perception …
From flocks of birds to fish schools in the sea, or towering termite mounds , many social groups in nature exist together to survive and thrive. This cooperative behaviour can be …
A koala bear isn’t actually a bear, it’s a marsupial. Whales aren’t fish, they’re mammals . Tomatoes aren’t vegetables, they’re fruit . Almost nothing is actually a nut . Peanuts, …
The rise of artificial intelligence has brought us more advanced toys. If AI Barbie and her talking robotic friends are going to raise our kids, what would their parenting style …
Who are you, who do you want to be, and what do you need to do to get there? We are constantly pushed to lead the perfect life. The media present us with a picture of an existence …
A Pomeranian dog in Hong Kong grabbed the international media’s attention this week after scientists found traces of coronavirus in the canine. Following confirmation that the …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Trading animal skins for pixels, our digital selves call for a digital wardrobe. The Institute of Digital Fashion , led by CommuneEast founder Leanne Elliott Young and Digi-Gxl …
In 2020, scientists made global headlines by creating “ xenobots ” – tiny “ programmable ” living things made of several thousand frog stem cells. These pioneer xenobots could …
In conversation with architect Julia Watson, a leading expert on Indigenous technologies and author of 'Lo-TEK, Design by Radical Indigenism'.
Erich Berger has a 96 year old grandmother who is a cyborg. She features dentures, hearing aids, glasses, pace maker, a metal implant on the pinkie toe, and more. Quotes from the …
Green electricity, Organic Shampoo, Jaguar convertibles, Red Bull, Bio Beef, Alligator gardening tools, Camel cigarettes and Puma sneakers. Once you develop an eye for it, it is …
Christian Schwägerl is a correspondent for Der Spiegel and the author of Menschenzeit (The Age of Man). He will be presenting his views on the Anthropocene at the Next Nature …
It’s long been a desire of the human species to have complete control over our own thoughts. We’ve all had these moments where we curse our brain. Asking questions like: “Why …
The world’s largest indoor farm is not the only firm developing vertical agriculture. Japanese company Spread plans to grow more than ten million heads of lettuce a year by …
A road safety campaign in the Australian state of Victoria exposed an educational, yet confronting picture to raise awareness to the vulnerable human body on the road.
Here's a look at how drones can and will impact the agriculture and farming industry.
We asked Sandra Rey, our third ECO Coin Award nominee, about her company Glowee and her hopes for illuminating the future in a more sustainable way.
The human body has always been an incredible machine, from the grand feats of strength and athleticism it can accomplish down to the fine details of each vein, nerve, and cell. …
In Ancient Greece the people were part of a direct-democracy, this means that they would directly vote for policies and laws. Nowadays, it seems as though this horizontal approach …
And it’s already showing incredible results. VR transports us to faraway worlds without even asking us to leave our chairs. Yet we usually hear about it in the context of video …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
There has been a surge in awareness of the damage that plastic pollution does to our planet in recent years. It has spurred a number of campaigns to remove single-use plastics …
Would you pray to a Robot deity? A group of Japanese buddhists is already doing so. Meet Mindar , the robot divinity shaped after the buddhist Goddess of Mercy, also known as …
A few years ago, convincing meat-free “meat” was nothing more than a distant dream for most consumers. Meat substitutes in supermarkets lacked variety and quality. Plant-based …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
With gyms closed and millions cooped up and restless at home, it’s little wonder that “healthtech” is now being billed as the next big battleground over which the likes of …
The image of the whole Earth as seen from space has become a symbol of the environmental movement. Time for an update?
Humans often claim to be at the top of the food chain, but is that really the case? We are experiencing – now more than ever – our own fragility: an increase in natural disasters, …
When the first baby is born off-Earth, it will be a milestone as momentous as humanity’s first steps out of Africa . Such a birth would mark the beginning of a multi–planet …
Humans’ natural sense of privacy helps them regulate the boundaries of public and private, but fail when trying to identify privacy risks in the online world.
We spoke with the Museum of Edible Earth, a travelling museum dedicated to the prosperous amount of soil samples.
It might sound like the title of a bad horror movie. But cultivating potatoes in space may soon be more than just fiction. Scientists and biologists are currently using simulated Mars and moon soil to experiment with space farming. One of them is space farmer Wieger Wamelink.
By ALEX WRIGHT, Published in NY Times December 2, 2007 The growing popularity of social networking sites like Facebook , MySpace and Second Life has thrust many of us into a new …
We are living in the future and we find it boring. The best place to gather evidence for this claim is the supermarket. To begin with, try and have a fresh look at the word: …
We tend to think of plastic as a cheap, inferior and ugly material used to make children’s toys, garden furniture and throwaway bottles. But as an experiment, imagine for a moment …
Recently, a video clip has been circulating the web that purportedly shows a rabbit born earless due to the radiation at Fukushima. BoingBoing has a convincing take-down of the …
While evidence indicates that humans domesticated themselves , we're not the only primates capable of self-domestication. Bonobos and baboons have shown they are just as capable …
Designer, artist and engineer Dan Chen has developed the ' End of Life Care Machine ', a machine designed to guide and comfort dying patients with a carefully scripted message. …
The Actroid robot holds clues for climbing out of the uncanny valley.
The humanoid robot Yangyang can function autonomously, talking and gesturing while interacting with people.
A team of cyborgs and digital enthusiasts developed a wearable technology for the body that perceives a human sixth sense.
The new Spectacles by Snap Inc. allow you to actually "make memories" (as their slogan claims) while capturing them.
Energy-backed money could help transition humanity to a more sustainable world, both environmentally and economically.
A recent study demonstrated how artificial light is a serious threat to plant pollination. It puts plant reproduction in danger, as well as the whole ecosystem.
Do you feel information overloaded? Do you experience stress? Do you feel like you are addicted to your smartphone, laptop, or the Internet? Get yourself digital detoxed!
Mythology still surrounds us, we just relate to it differently. Games and movies have replaced pantheons and folk tales. Fairies and gnomes left the forests and the rivers and moved to virtual realities.
Looking for a self-sustainable mobile microhome? Ecocapsule got you covered. This cute-as-pie capsule pod allows you to live completely off the grid in a low-energy, mobile …
Color-blind artist Neil Harbisson designed a brain-implanted antenna that converts colors into sound. This enables him to hear colors he cannot see, and extends his vision to …
This story is part of Next Generation, a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
The way people get around is starting to change, and as a professor of transport strategy I do rather wonder if the modes of transport we use today will still be around by the …
Oded Ezer is a typographer from Israel who never fails to push boundaries, or rather, discard them altogether. Ezer is a rebellious force that swings between commercial and …
The new Next Nature book is here ! Next Nature fellows, ambassadors, members and newly interested people came together on the 4th of June to celebrate the book launch with a …
Historians often trace the dawn of human civilisation back 10,000 years, when Neolithic tribes first settled and began farming in the Fertile Crescent, which stretches through …
Facial recognition is increasingly being used in many countries around the world. In some cases the take up has been dramatic . As a result, people are being observed by cameras …
We live in turbulent times. Thanks to science and technology, we are able to perceive our environment down to the atomic level. We can read DNA, manipulate cells, cut and paste …
If we are to build a greener, fairer and more equal society in the wake of COVID-19, it’s time for rich countries to end their practice of dumping plastic waste in developing …
In July 2018, a century-old red oak went live on Twitter. The account @awitnesstree , tweeting from the Harvard Forest in Petersham, Massachusetts, introduces itself in its bio: …
Assisted evolution raises complex questions. The practice involves human intervention to increase the rate of natural evolutionary processes. A technique that inevitably …
To pay tribute to the destroyed orange petunias during the Petunia crisis, Klaus Pichler has composed an illustrative book.
The annual Bio Art & Design (BAD) Award encourages new artists and designers to explore the world of bio art and design. Let's have a look at the three winning projects of this year.
The free cultural paper Amsterdam Weekly discusses the Natural Revolution of and includes tree tips for successful living in the next version of nature. Download PDF (148kb) . …
May 17th 2008. Biggest Visual Power Show: Next Nature in LA . More pictures below. We are all born in a world that has been designed already. BVPS intro video by Floris Kaayk. Big …
We’ve written earlier about man–made bacteria that eat waste & shit petrol . How about a genetically modified bacteria that can eat CO2 and excrete methane that could power …
Imagine your cruise to the Galapagos came with a ghoulish warning: "Your hair will fall out, your skin will blister, you'll probably get cancer and your children's children might …
As cities push to the edges of the wilderness, wild animals are increasingly com
The surprising results of a year offline in the "real" world.
In vitro meat is creepy, unnatural and downright disgusting – and so is every other kind of food we eat.
Media artist, filmmaker and wonderjunkie Jason Silva talks about technological evolution and why humans are gods with anuses.
Outside of the limits imposed by the edges of an animal’s body, the cells can reproduce and multiply until they exhaust the nutrients and space provided, filling petri dishes and vats to grow the future of meat.
Food and Concept designer, Chloé Rutzerveld, explains her 3D food printing project Edible Growth.
The Campaign Against Sex Robots, recently launched, is pushing towards banning the continuation of sex robots development.
The new year is right around the corner, let’s forget about long-term future for a while to check out what new tech trends will hit it big in 2016. At the end of every year, …
According to a study our PC, equipped with a list of things we "Like" on Facebook , knows us better than our friends.
Google's PlaNet will be soon able to tell you where a photograph was taken by simply looking at its contents.
Replacing your old heart with a new heart from an animal may seem extreme? Well, this future may arrive sooner than we think.
It took less than 24 hours for Twitter to corrupt an innocent AI bot and teach it morally repugnant things.
Researchers prove that pristine landscapes haven’t existed for thousands of years, therefore we should change or mindset before trying to save the planet.
What if your co-worker was a robot? Dutch startup Smart Robotics is a job agency for robots that allows you to hire a smart-robot.
We met Anouk Wipprecht and talked about smart fabrics and accessories that can listen to our body, therapeutic fashion and the future of dressmaking.
Meet Josh Tetrick, entrepreneur who wants to reinvent the food industry and plans to launch lab-grown meat on the market by the end of 2018.
What if we could redesign the system to work for humanity and the planet we call home? What would the economy of ecology look like?
The way we interact with the technology in our lives is getting progressively more seamless. If typing terms or addresses into your phone wasn’t easy enough, now you can just tell …
Meet the Robo Wunderkind, a new breed of smart toys that introduces children to the basics of coding and robotics in a playful way. Advanced technologies are increasingly embedded …
Leather is one of the oldest and most versatile materials in the world. It’s a supple, tough, relatively strong and durable material and it’s relatively impermeable, yet …
The world of design is in need of new materials that align with the urgency for sustainability. Issues such as climate change, plastic waste and harmful materials require us to …
The Singapore Food Agency has approved “chicken bites” containing meat made from real chicken cells that were grown outside of a chicken’s body. Alongside similar news from Israel …
At just a millimeter wide, Xenobots are “neither a traditional robot nor a known species of animal", they are "a new class of artifact: a living, programmable organism”, says …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Our deficiencies have always driven us, even among our distant ancestors, back in the last Ice Age. Having neither the speed and strength to hunt large prey, nor sharp teeth and …
Although it’s seductive to think of human beings as the dominant species on earth, many others play important roles too. Bacteria, insects, algae colonies, rocks and the …
As with many of the products we consume, there’s a cost beyond what we pay at the store. Producing coffee has an environmental cost, too.
The human world often sees itself as separate from the rest of the natural world. Because we have deemed ourselves, ironically, as higher functioning beings over all others on …
Every piece of plastic that’s ever made, still exists. It results in a floating garbage dump in the ocean, full of life. While this (geo)design was never intentional, humans …
In the digital era of a globalized world, our screens have become a second set of eyes. Communication has advanced leaps and bounds, to a point where we cannot imagine a world …
A German artist refused a photography prize after admitting his image was AI-generated.
Exploring the intersection of technology and art, a team of creatives presents a virtual performance that pushes the limits of human expression.
We have identified eight key defining moments that tell the story of geodesign, from ancient insight to artificial intelligence.
When Earth goes south, cowboys go all the way up. The Space Rush of 2020s has something to do with settler colonialism.
Fakeness has long been associated with inferiority. Fake Rolexes that break in two weeks, plastic Christmas trees, leaky silicone breasts that cause cancer, imitation caviar. Even …
Are we on the verge of a future human evolution, one that isn’t, at least in it’s very core, “the survival of the fittest”, but rather “the evolution of the richer”? Think about …
My name is Jason Silva. I've spent the last 5 years hosting and producing a tv show on Al Gore's Emmy-winning Current TV network and I'm a fellow at the Hybrid Realities …
Look around you and try to find the most natural thing in the room you are in now. It is you. Now, you wouldn’t be so sure in the apocalyptic Los Angeles of 2019 depicted in Blade …
In Next Nature, not only old nature is being idealized. Because of the rapidness of new emerging technologies, we have a tendency to dwell on earlier prototypes. To recall …
Many people will have heard of the infamous swastika made up of larches that revealed itself every autumn in a forest outside Berlin . The trees, which turned yellow at the end …
Sexuality and sensuality are phenomena which have been a nature for us as long as we humans exist. Not only humans experience these phenomena; also animals experience sexuality …
If you happen to be in the neighborhood you might want to drop by at the exhibition Post Natural Organisms of the European Union in Amsterdam. The small but delicate expo, curated …
During the late 1930’s the philosopher Walter Benjamin wrote its widely influential essay ‘The work of Art in the Age of Its Technical Reproducibility’. While describing a general …
Bio-hackers developed a protocol to augment human sight to see into the near infrared range.
The top three aspects why people should support cultured meat.
Technology helps us understand the unfolding of the Anthropocene.
Stephen Hawking gives his opinion on what technological unemployment, aka machines taking over our jobs, can represent for future human societies.
The world’s largest indoor farm in Japan is 100 times more productive than traditional agriculture.
The human ear is a miracle of mechanical evolution. It allows us to hear an astonishing range of sounds and to communicate and navigate in the world. It’s also easy to damage and …
Yearly 90 million metric tonnes of methane are burped and farted into the atmosphere by cattle with effects on climate change. Researchers are looking for ways to change the cow's diet, feeding it oregano, seaweed and super grass.
With the evolving technique called EEG, electroencephalography, we can measure brain activity and ultimately even read the brain.
Future workspace, human interaction and unique experiences: here’s how artificial intelligence and VR impact on architects and engineers.
We asked Ritsert Mans, our second ECO coin award nominee about his bike, the technology that fuels it and his hopes for the future.
Read our conversation with the ECO Coin Award Winner of 2015: Yoyo Yogasmana.
The gift giving season is once again upon us and to help out those who are struggling to find that perfect gift for that special someone we have brought together a collection of Next Nature inspired gifts.
An "electronic personhood" for robots has been discussed in the European Parliament recently, raising big questions about equality, citizenship, legal and ironically, human rights for artificial intelligent machines.
If humans would disappear from the face of the Earth today, we would still leave 30 trillion tons of mass in the geological record. Certainly, "we were here" is written all over.
How many cyborgs did you see during your morning commute today? I would guess at least five. Did they make you nervous? Probably not; you likely didn’t even realize they were …
Sports have always had an important place in human societies, providing entertainment, exercise, and a demonstration of the exceptional things the human body can achieve. But in a …
Virtual reality has come a long way. Like most technological leaps, it’s had a huge push from the entertainment industry, but current applications span a wide range of social and …
We sat down with Shahar Livne, an Israeli-born designer who graduated from the Design Academy in Eindhoven to talk about her vision on the future of plastics.
Astonishingly, we’re still living in a world where most women feel uncomfortable talking about their periods and some don’t even have access to sanitary products. This is why …
Today, there's an app for everything. They help us satisfy our cravings, allow us to communicate at all times and make it easier to share special moments. But the dark, cold …
This year we are proud to announce that, with her ambitious work within the field of bioluminescence for Glowee, Sandra Rey is the ECO Coin Award 2017 winner.
Robots are coming for our jobs. Virtual reality is coming to make the jobs that remain easier to accomplish. All of the world’s manufacturing sectors are in the process of …
In response to the nitrogen crisis, the Dutch cabinet is planning to reduce the speed limit during the day to 100 kph. In itself a sensible decision. But it is strange that this …
As evolution goes on, the human body is evolving too. What does it mean to be human in times of advanced biotechnology and genetic engineering? Are our bodies ready for our …
You might already have what’s often called a “smart home”, with your lights or music connected to voice-controlled technology such as Alexa or Siri. But when researchers talk …
Pink chickens, synthesized tiger penises and salads grown from bodily fluids - how could they shape our future? In a Next Nature collaboration with the Gogbot Festival, the …
Transforming the way we travel is an essential part of tackling the climate crisis. The transport sector contributes about 20% of global carbon emissions . In the UK the figure is …
What does it mean to become a cyborg? Better yet, aren't we cyborgs already? What then, does it mean to have a body? Is a 'standard' desirable, what does that even mean, and what …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Interior based on bacteria, spaces morphing perception and the merging of man, animal and machine. These five must see exhibitions in the Netherlands explore the intersection of …
In the past few years, scientists have hatched some pretty crazy-sounding schemes in the name of protecting Earth and its inhabitants. From building an underwater wall 120 …
The world needs interdisciplinary creators who are designing not just for humans, but for the rest of the living planet. To foster this thinking, Biodesign Challenge (BDC) pairs …
The deepest regions of the oceans still remain one of the least explored areas on Earth, despite their considerable scientific interest and the richness of lifeforms inhabiting …
In imagining future urban landsapes, we need to answer questions about what can be sustained and what cannot, where cities can be located and where they cannot.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch: magazine@nextnature.net. …
Cyborgs - part human, part machine - are becoming more present in society, but their rights are not yet established.
What is the meaning of art on the moon? Artist on the Moon is the latest project from Icelandic visual artist Borghildur Indriðadóttir , who aims to perform for the stars and …
What if living objects could re-connect humans with their menstrual cycle and change the way we perceive it?
Wondering how next natural furniture may change your way of life? Will we feed our lamps? Grow chairs? Talk with our tables?
Researchers from the University of Colorado created a recipe book to cook with mycelium.
No self-respecting manager would be without a BlackBerry. But now these handheld gadgets, which provide workaholics with constant email updates, are being blamed for chronic …
This years edition of the Ars Electronica festival , which has been hangout for international experts from the arts and sciences for almost three decades, focuses on the nature …
Sind wir noch zu retten? That was the slogan of this year’s Ars Electronica festival in Linz (Austria). Titled ‘REPAIR’, the media art festival urged to leave our scepticism and …
Talking about nature and nurture as separate, clear-cut forces is far adrift from the complexities of developmental science, says Evelyn Fox Keller in NewScientist . ONE of the …
I should tell you the story of how Manko lost a leg. You need to know about this incident to understand his recent works. So please forgive me, I first have to go back to that …
Lady Gaga is famous for fashion that exaggerates or obscures her body, but a few months ago, she made a foray into 'actual' body-modification. Gaga appeared on Jay Leno's talk …
Until now, most people have likely regarded bird-feeders as merely a pleasant addition to their gardens. But scientists have now discovered that bird-feeders in the UK are …
Recent work of artist Jalila Essaïdi exemplifies of how science and art can meet and create meaningful inventions for society. Jalila Essaïdi used the spider silk produced by …
Manko had been here before. Being just thoughts, surrounded by nothing. He felt glad his thoughts were there, one after the other, so there had to be a form of time and therefore …
When Nada returned as promised with a small bowl of soup in her hands, Manko was sitting upright with a grumbling stomach. Even now that Manko could see normal again, Nada's hair …
The One Laptop Per Child program is experimenting with what at first seems to be the lazy way to philanthropy: dropping off tablet computers in remote Ethiopian villages and then …
Climate change is one of the biggest challenges of today and various scenarios, ranging from artificial trees , pollution trading , co2 capturing to geo-engineering, have been …
Excerpts from the Rebbit AMA with Andras Forgacs, founder of a company that manufactures in vitro meat.
Alexandra Daisy Ginsberg discusses the promises and realities of synthetic biology.
British philosopher David Pearce believes we should to stop animals from hunting and killing other animals.
A selection of nine enthralling and striking concepts of future way of transportation.
Digital bits have lives. They work for us, but we totally ignore them. What do bits really want? Here are the life stories of four different bits.
Many scientists believe that we will soon be able to preserve our consciousness indefinitely. This could be done by copying and transferring these contents into a computer, or by piecemeal replacement with parts of the brain gradually replaced by hardware.
Computer can already beat us in many tasks. Complicated calculation, processing speed and chess, to name a few. However, generally speaking, you’re still likely to be more …
There is a new artificial skin technology that could give humans magnetoception in the future.
Earlier this year, a group of Chinese scientists published a paper about the modification of the genome of human embryos with the cutting-edge powerful technique called CRISPRs. …
An international team of scientists used nano-sized needles in order to promote production of new blood cells.
Robert Gordon says all the major inventions have been made, but that's only true for our limited knowledge of future possibilities.
Facebook had just fired their curatorial team for the ‘Trending’ news section over an algorithm, resulting in false stories attacking a news anchor, a writer, and Mac Donald’s.
A group of researchers is working to optimize the way we sleep, increasing our relaxation, and therefore reducing the time devoted to our naps.
We are entering an age of technological singularity, in which artificial intelligence and biological enhancement are combined in order to construct the next stages of human evolution.
We tend to believe that the fruit and the vegetables we eat today are "natural" and the same as they always were. It turns out that in the past this familiar food didn't look like this at all.
With virtue signalling, the joys of moral superiority are just one click away!
Lunar Insurrection is a group of architects that explores the creative possibilities of the moon as a potential territory for human activity and inhabitation. In Vol.2 , their …
Additivism is a movement that calls for radical rethinking of new technologies, such as 3D printing, the plastification of the world and our human position within it.
A new wave of automation lies in pizza. Not only will robots deliver your pizzas in the future, they will even make them.
Welcome to the access and experience economy. Currency: sweat, blood and action.
The Modular Body is an online science fiction story by Floris Kaayk about the creation of OSCAR, a living organism built from human cells.
The principle behind a time based currency is usually very simple: one hour of work equals a unit of time.
The term "ecotogenesis" was first coined in 1923 in "Daedalus".
Chef Watson knows over 10.000 recipes. The highbrow robotic cook invited us over for dinner during the first Neo-Futurist Dinner at Mediamatic.
Farming is more than manual labor. The hard part is knowing how to get the best yield. Thankfully, there’s an app for that: growing crops in silico.
We recently interviewed Lining Yao, Chinese interaction designer who uses organic materials as a technology that brings us back to nature.
Imagine being able to enter your office through a digital representation of reality. It sounds crazy, but it’s possible with augmented and virtual reality.
Remember the Modular Body? Curious about how OSCAR was really created or keen to know more about the project as a whole? Check out the making of videos!
Have a look at our series Robots at Work! In this episode we present you five jobs for creators, the ones that build with their hands.
Where contraceptives such as the pill disconnect sex from reproduction, in vitro fertilisation disconnects contraception from sex, and the artificial womb would disconnect the …
The world’s first bio-brick grown from human urine has been unveiled by University of Cape Town (UCT) master’s student in civil engineering Suzanne Lambert, signalling an …
To all in vitro meat optimists, hear hear! In May 2018 we launched the petition ' In vitro meat is here. Let us taste it. ' We proudly announce that this petition led to …
Are you working on projects where technology and human interaction are involved, and are you looking for a new approach? As of today, we offer a brand new workshop concept for you …
Nominate an inspiring project, platform, person or community who is tackling food waste for the ECO Coin Award 2018
Urban neighborhoods with high-rise concrete buildings are often dreary and gray. Therefore, the Urban Street Forest project aims to color our cities with the planting of vertical …
This question is an excerpt from the Pyramid of Technology toolkit Cooking is a process through which humans outsource part of their bodily functions to technology (think …
As a young bio designer at the start of your career, you'll have to overtake all kinds of obstacles. From the collection of living materials to working in a laboratory and …
What do a kingfisher, cocklebur pods and a Namibian beetle have in common? Besides being living organisms, they have all served as inspiration for creative human technologies to …
Earth’s oceans are having a rough go of it these days. On top of being the repository for millions of tons of plastic waste , global warming is affecting the oceans and upsetting …
Intensive agriculture may be nourishing most of the Earth’s inhabitants, but it’s doing the opposite to earth itself. Its dependence on singular crops, heavy ploughing machinery, …
You’ve probably heard how Virtual Reality (VR) is going to change everything: the way we work, the way we live, the way we play. Still, for every truly transformative technology, …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
As the viral pandemic continues to spread, so too does the world’s collective uncertainty. As a result, people are turning to media for some levity. And can you blame them. …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Where were you on the 4th October 2021? During the day that will be remembered for the Facebook outage, not everyone was equally impacted.
Imagine if you could power your kettle using the energy generated from the vegetable cuttings quietly breaking down in your kitchen’s compost bin. That reality might not be so far …
If you were to stack up all the electronic waste produced annually around the world it would weigh as much as all the commercial aircrafts ever produced, or 5,000 Eiffel towers. …
As humans have industrialised farming to feed a growing global population, pollinators – animals vital for plant reproduction – have seen their food supply decline. In the UK, …
Benedikt Peirotén has started a project called ‘From the Ashes’ proposing using waste streams to replace the energy-intensive ingredients in glass.
What if humans would be able to listen to what nature has to say? Conservationists are trying to grasp non-human sounds , which might help us to better understand environmental …
Imagine a trash can that matches the size of your ordinary bin, yet it scoffs at weeks' worth of discarded food before even considering fullness. You're off the hook, as there's …
For mobile gamers in western Japan, a hearty seafood dinner awaits just a few key clicks away, thanks to a unique new cellphone fishing game that rewards successful players with …
Some weeks ago we pondered over the oddity of a space race in cyberspace . Rockets and jet-packs –so cool in the previous century– don't make sense in a virtual environment. The …
It is official: the Green Blues has begun. Almost all bio-fuels used today cause more greenhouse gas emissions than conventional fuels if the full emissions costs of producing …
Economy is ecology? Technology Review writes the price of oil has dipped to levels that could be far too low for many advanced-biofuel startups to succeed, especially those that …
By MARCEL VAN DER DRIFT. Ten years from now, a cell phone gently sinks to the bottom of the river. It's one of the latest models. The clever design, trendy colours and nifty …
Are you ready for some techno-optimism? Buckle up and enjoy the ride with bio-tech evangelist Gregory Stock . Some quotes from his prophetic TED talk : "We are seizing control of …
The next step in biomimetic body extentions for propelling yourself through water. Man moves on from copying ducks to become a dolphin-like cyborg. With these fins you can be …
While most people are still prudently changing light bulbs and recycling coffee cups to fight global warming – or at least their gnawing conscience – policy-makers have long moved …
Once, we wore footwear to protect our feet from the hostile influences of our natural environment. But with the replacement of our natural environment by a world of design, the …
Nature demanded that we make a choice between immortality and sex, but the Next Nature of the 21st century may not. For help, we can look back to the 20th Century, which had many …
Did you know that about 20 percent of your body isn't really yours? It has been patented by some corporation you probably never heard of. You can't patent gold, you can't patent …
The Berkeley Robotics & Human Engineering Laboratory is researching a way to improve the performance of human bodies. They are doing innovative research in the field of …
Some months ago we wrote about the dream of mechanical-engineer Jarno Smeets to fly like bird . Over the last few months Jarno worked steadily to materialize his dream. Today …
After the successful introduction of the NANO Supermarket in 2010 it became even more clear that the contest and the presented results produced discussions and many challenges to …
An ingenious Russian crow that used a lid as a snowboard to slide down a snowy roof persuaded millions of YouTube viewers that animals are not merely beasts of burden – they also …
There's a new threat to the world's unemployed. Researchers at Carnegie Mellon University have developed a robot that helps to organize shop inventories, making that trip to the …
How geology and humanity turn ancient algae into high-tech gadgets.
Breeding parasites to improve immune function, skin tone and even resistance to poison.
Engineering mosquitoes to ignore the scent of human flesh.
In the movie Fantastic Voyage, a submarine and its crew were shrunk and injected into the body of a sick man in an attempt to save his life. Despite the fictional nature of this …
A new wearable device provides runners with info on posture, rhythm and stride length.
A entomologist gives another explanation for that famous fruit fly with ant-patterned wings: it's not evolution, it's human error.
Due to human action, 1300 bird species are seriously in decline. Other birds have learned to live with humans and profit from their presence.
In 1992, decades before the era of wearable technology, Apple produced its first watch: no apps and vintage design.
Sixteen-year-old Japanese singer Hatsune Miku grew in short time to a worldwide popstar. With her colourful appearance she counts millions of followers on social media, she …
Economy and ecology are two spheres that usually do not cooperate. Thanks to the ECO coin the environmental value can be conceived economically. A currency that can be earned by …
A startup called New Wave Foods is developing artificial shrimp meat in the laboratory.
Zackary Scholl developed a program to produce a poem that passed the Turing Test.
A futuristic Japanese hotel will be run by robots, designed to be extremely human-like.
Researchers discovered that people's reactions to 3D images of facial expressions are more emotional than the responses to classic 2D images.
Companies try a new, more secure payment system using selfies.
A promising way to grow body parts: using an apple.
Soon we won’t program computers anymore, we’ll train them like dogs.
Robots in health care could lead to a doctorless hospital.
While robots are becoming more and more human, with all their sensors and information processing abilities, may it be likely that they too could develop mental illnesses?
Genetic engineers are developing techniques to kill several types of mosquitoes.
An industrial robot just tattooed the first person ever in San Francisco.
A driverless convoy of trucks drove through Europe and safely arrived in Rotterdam yesterday.
As the digital age makes people more lonely, Chuck McCarthy created a service to walk with strangers.
According to a new study, humankind is now entering the "Age of Plastic". The research investigates the evidence that we are living in the Anthropocene, a time in which humanity is the main geological force.
NNN is currently doing a preliminary research into the idea of the artificial womb. This timeline will help you navigate through the investigation.
On August 8, NNN gave a workshop at BioClub Tokyo to share some insights on the future of technologies concerning human reproduction, sexuality and relationships.
The endless runway is a new airport concept by Dutch scientist Henk Hesselink.
Ecosexuality reconceptualizes our perspective on the biosphere by having consensual experiences with it.
Last week, our NNN fellows gathered to discuss the Next Habitat; how will we work in the future? And how does this affect our personal lives?
We fear being replaced by robots. They have the potential to be smarter, stronger and more hardworking than us, but so do horses.
A horse can run faster than a human, yet nobody claims horses will make mankind dispensable. When a man rides a horse and the two work together, something new happens. Then, what …
“An illegal theme park exposing the ideology of the aesthetics of hacking”. “A hybrid drone targeting technological domination”. “A psychedelic fridge to raise doubt about fake …
In the next nature, many people spend as much time in the digital world of gaming as they do in the real world. We have covered video games before, but this year we thought it …
This is post number one of our serie 'Robots at Work'. In this episode we present you five jobs for caretakers, the ones that work with their hearts.
A new report recommends that we decide the legal status of robots sooner rather than later. It even suggests that they could be given personhood and rights.
Smartphones have become almost a part of who we are. According to tech industry experts, however, the smartphone's days are numbered and that number is lower than you might expect.
At Border Sessions Festival in the Hague a workshop was hosted by Next Nature Network on the artificial womb.
In various parts of the world, access to education is, or risks becoming, a huge crisis. UNESCO estimates that around 20 million new teachers are needed worldwide - and that's not …
Do you ever look at the bonnet of a car and see a face? Now, designers are looking at how to give self-driving cars the friendliest "faces" they can through anthropomorphism.
We need to change the way we power our daily lives. Burning fossil fuels is the primary cause of climate change, yet this is still our main source of energy. Much of this energy …
Humanity is facing the disconnection between biological reproduction and the body, facilitated by the emerging technology of the Artificial Womb. Envisioned in bleak science …
The Living Light harnesses plant energy to provide light. We spoke to its designer, Ermi van Oers, to find out more about the unique product.
If you teach a robot to fish, it’ll probably catch fish. However, if you teach it to be curious, it’ll just watch TV and play video games all day. Researchers from Open AI …
Before money came into existence, trading was all we knew. Farmers in China traded their spades for food and other goods, and this continued up until a point where most spades …
Back in the mid-twentieth century, before the first moon landing, people had all sorts of ideas about the golden age of space travel in front of them. Colonize the moon! Fly …
While many love to speculate about the sheer number of jobs that robots and artificial intelligence are going to replace in the near future, no one seems to be coming up with any …
Globally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …
“Within a few years it will be possible for a premature baby to continue to mature in an artificial womb,” says gynecologist Guid Oei. It is therefore that the Artificial Womb: …
With New Year’s resolutions in full swing, many people may have chosen to cut down on their tech use – or even give it up altogether. The growing popularity of such “digital …
“Please refrain from hand shaking" is a common sign we now see as a result of public health organizations advising people to avoid shaking hands as a greeting. As people still …
We live in a world in which we control the biology of a tomato at such precision, you could think of it as a product of technology, instead of a product of nature. Think about it, …
Recently, Twitter announced it would be clearing all inactive accounts in an effort to free up dormant usernames and prevent the risk of old accounts being hacked. The new policy …
From all the memes that have reached me through my screen since the outbreak of the corona pandemic, there is one that perfectly reflects my thoughts in the beginning of March …
With 7.9 billion people and counting, the Food and Agricultural Organisation of the United Nations predicts that by 2050, food supply needs to grow by 70% in order to accommodate …
While the pandemic has restricted us from doing many activities we like, household hobbies such as DIY , baking and crafts have become more popular. Now there’s a way to combine …
The three winners of the Bio, Art & Design (BAD) awards have been announced.
You are in for a surprise when you look at food and concept designer Chloé Rutzerveld 's portfolio. It is hard to believe that somebody so young - she is just 25 - has already …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
The commercial race to get tourists to space is heating up between Virgin Group founder Sir Richard Branson and former Amazon CEO Jeff Bezos. On Sunday 11 July, Branson ascended …
The extent to which new technologies are intervening with everyday life can hardly be underestimated. Virtual realities, nano- and biotechnology are increasingly providing new …
Behold the featherless chicken, created by Scientists at the genetics faculty at the Rehovot Agronomy Institute near Tel Aviv, Israel. The idea behind the development of this …
There are people who think what makes a good wine comes from nature - factors like rain and soil and temperature. Then there are those who think it's a matter of second nature - …
In the UK farmers recall simple circles appearing on their land for generations. The British media first reported on the circles in the early 1980s. By 1990 crop circles had …
The Earth is heating up. The sun will blow up within 5 billion years. The human race will probably go extinct before entering the posthuman stage, or the probabillity that we are …
Nowadays, children know more corporate logo's and brands than bird or tree species. The average Western person has more worries about the instability of financial markets and …
Human-product relationships increasingly play out in a realm which was previously considered exclusive for human-human and human-animal relationships. Panasonic now redesigned one …
A future physical anthropologist who knows nothing about the human race and would dig up a contemporary desktop computer, might conclude homo desktopus must have been the user of …
Whoever you are, whatever you do, wherever you may be. You can’t beat the real thing. It really refreshes and brings real satisfaction in every glass. It was not until America’s …
Mondrian would have appreciated square trees. Furthermore, they would enable wood industry to lose less material, to cut easier with machines and to store more efficiently. Hence …
Paradise by the Laptop Light is a next nature event with short films, speedlectures, special guests and one laptop. It will be held on 12 September 2008 16:30-17:30, as the …
Scientists have begun to examine how the city affects the brain, and the results are chastening. Just being in an urban environment, they have found, impairs our basic mental …
No, this is not another example in our fake for real series , comparing an artificial with a human hand. Rather, you are looking at twice the same hand: with and without its …
Japanese researchers of the Central Institute for Experimental Animals , took a green fluorescent protein gene of a jellyfish, wove it into the DNA of a few marmosets embryos, …
On May 12, 2009 the ACLU and the (not-for-profit) Public Patent Foundation, filed a lawsuit, charging that patents on two human genes associated with breast and ovarian cancer are …
So you think climate change is new? So you think the flooding of landmass by the oceans is a new? So you must have not heard of the times when people walked from London to …
Anthropomorphobia is the fear of acknowledging qualities we wish to consider only human in non-human things. Sufferers from the condition used to have trouble mostly at fairs or …
Kevin Kelly -- senior maverick at Wired -- asks people how they see the internet and if they can, visualize it. Here is how: "The internet is vast. Bigger than a city, bigger than …
WiredScience writes: Hackers who commandeer your computer are bad enough. Now scientists worry that someday, they’ll try to take over your brain. In the past year, researchers …
Remember Asimo ? Honda has now developped a new Brain-Machine Interface technology that allows humans to control the humanoid robot simply by thinking certain thoughts. The BMI …
Nanotechnology is an important emerging technology of our time – it radically intervenes with our sense of what is natural – yet most people are still relatively unaware of its …
The Quest for Fire (1981) shows the Next Nature of 80.000 BC. Set in a world without highways, supermarkets, airports, Internet, television, farming, money or written language, …
Koyaanisqatsi (1982) is a film with no actors, no storyline, and no dialogue. The only things we see are landscapes, images of cities, and people going about their regular lives. …
No shellfish, no peanuts, no soy, no milk, no eggs. An increasing number of people suffer from various food allergies, which force them to constantly scan food packages for …
Mobile phones may be the most affective technology we own but researchers at the Design Research Lab in Berlin have taken this notion to its most outlandish limit. Their cellular …
Manko blinked. Then blinked again, and again and again. While he did, he went through various layers at once and he was dazzled and amazed, his jaw dropped at all that he saw. He …
For other entries and an introduction to the 11 Golden Rules of Anthropomorphism and Design, click here. People have evolutionarily built-in mechanisms that help us to …
Nearly every adult in the Western world owns a personalized pet, sometimes more than one . It is treated with great care, fed when necessary and fitted to the owner’s wishes and …
Artist Arne Hendriks explores the possibilities and implications of downsizing the human species to better fit the earth.
The future of farming is not to be found in further mass-industrialization nor in the return to traditional farming with man and horse power, but rather in swarms of smart, cheap robotic farmers that patiently seed, tend and harvest fields one plant at a time without the need for damaging pesticides.
The uncanny valley, a phrase coined by Japanese robotic researcher Masahiro Mori nearly three decades ago, describes the uncanny feeling that occurs when people look at …
This last Monday rang in the Chinese Year of the Dragon. Not restricted just to the benevolent, snake-like creature of Chinese mythology, or to the greedy, princess-stealing …
Humans act as bio-excavators that literally move mountains.
Illustrators from the 1800s to the 1950s offer strange prediction for the future of meat.
A device that remotely controls cattle's movements promises to transform the American landscape.
More remarkable than the look and taste of the burger, which only stood out because it was presented in a petri dish and described by one of the panelist as 'hot', was the revelation that Serge Brin, co-founder of Google.com, financed the project.
Tech experts are betting that they can make vegetarian eggs that outperform the real thing.
About 4 or 5 million years ago, major changes in the Earth's climate brought about grassland regions where giant mammals could graze.
The more we look like ads, the closer we get to some ideal of beauty, the more off-putting we find the results.
Designed by a dancer, a new wheelchair moves intuitively with the user's movements.
JAXA developes a net that could collect debris from outer space.
A jury of design and science experts awarded the best NANO Supermarket product a € 2.500 prize.
In this approaching era, what might be biologically possible for plants?
To attract a female, male bower birds build structures and adorn these with colorful plastic decoration.
Power Loader: the power amplification exoskeleton robot.
It's more than two years since I have started this exploration of the Anthropocene for Next Nature for you. We have visited many places together, places I have traveled to as a …
Thanks to the work of researchers at Cornell University (USA), for the first time a litter of puppies was born entirely from in vitro fertilization.
Conceptual designer Thomas Thwaites is currently investigating and experiencing to live life as a goat.
Starship, a robot that will remodel our local deliveries system.
Google plans to connect more than 100 million people in a cheap, new and sustainable way, in a territory where only one person on three has access to the Internet.
This piece from Ars Technica details the breadth in the variety of energy sources emitting from our every day interactions.
It seems thinking machines could put the human race in danger. How realistic these fears are?
Stewart is a tactile interface that mediates the communication between human and self-driving car.
Nasa funded a program to turn astronauts’ poop into food.
New study suggests that the real environmental problem is embodied in the things we buy.
Dave Hakkens wins the 2016 ECO coin Award for his incredible work on the Precious Plastic recycling machines.
A report on the Empowered by Robots conference during DDW16, demonstrating fruitful collaboration between humans and robots.
There is an artificial intelligent robot called ROSS that is taking over the work of thousands of lawyers. Working non-stop, reading faster then any human attorney can do.
The Octobot is the first of its kind made fully of soft materials and is aimed to pave the way towards a more safely interaction with humans.
A new community currency that rewards recyclers with local discounts and deals.
Big data is reforming politics, but is it for the better?
An Australian study has shown the use of lifelike robot babies increased teen pregnancy, rather than discouraging it.
Garbage dumps may not be very attractive places for us but they sure are for animals. A study published in Science Advances shows how certain groups of storks modified (and …
How wild animals and cities are adapting to each other.
Part one of a ten part series exploring the design of an invisible technology: money.
What happens to robots that are no longer needed? In the future robots will be biodegradable.
Special balloons able to catch the rays of the sun from above the clouds, producing clean energy day and night thanks to the help of a fuel cell.
Emoji are taking our communication to a faster, simpler level.
A lamb born at the equivalent of 23 weeks in a human gestational period was kept alive in an artificial womb and developed just as if it was in a normal womb.
Aldous Huxley published Brave New World in 1932, bringing the idea of the artificial uterus to the big audience.
The AI chef nows more than 10,000 recipes from all over the world and is capable of combining any ingredient while following your personal food preferences.
With her project Future Food Formula, food designer Chloé Rutzerveld is looking for innovative methods to design vegetables.
On July 21, 22 and 23 you are invited to join us at Welcome to the Village festival in the Friesland province of The Netherlands for our next iteration of the ECO coin!
This live stream video of a Bald Eagles family nesting in Florida has counted more than 72 million viewers.
What if you could unlock your phone by simply looking at the camera? According to Apple, this is precisely how the iPhone X will work. But how secure is it?
The robots have arrived! Yesterday we celebrated the launch of HUBOT , job agency for people and robots at MediaMarkt , as part of the Dutch Design Week in Eindhoven. Our virtual …
The sun sustains our planetary system. Its energy fuels life. And in the future, the sun will also fuel our cars. That’s the premise of Dutch startup Lightyear, a startup specialized in solar powered electric cars.
A clinical startup sells millennial blood to reverse aging.
DNA is the densest known storage medium in the universe - and Harvard University researchers have managed to use it to store GIFs inside bacteria.
How about a peddling ride accompanied by the sound of babbling water, with the awareness that what you are leaving behind is nothing else but clean water?
Humans and robots can work together to maximize the potential of both and boost productivity to new levels.
Last night we were invited to celebrate the plenty at the third edition of the Neo-Futurist Dinner series at Mediamatic in Amsterdam. This time, the night was hosted by Dutch …
Blockchain is useful for more than cryptocurrency. It’s revolutionizing industry after industry. Next, it may change the way we get our food. The agriculture industry is complex. …
A respected astrobiologist argues that a radical new process called geoengineering might be the only way to save us from climate change.
Globally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …
The ECO Coin Award honours outstanding ecological heroes. In 2015, we handed out our first ECO Coin award to Yoyo Yogasamana for his digitalization of sustainable knowledge to …
Tonight a flock of drones can be seen in the skies of Amsterdam.
Scientists believe the introduction of a hormone-like system, such as the one found in the human brain, could give AI the ability to reason and make decisions like people do. …
People across the world have been eating insects for thousands of years. We know that approximately 2,000 species are edible and that these insects are eaten in many different …
It may soon be possible for your phone to automatically figure out whether it’s you or your five-year-old who’s swiping the screen—and, if it’s the latter, block apps you want to …
Scientists have created a mutant enzyme that breaks down plastic drinks bottles – by accident. The breakthrough could help solve the global plastic pollution crisis by enabling …
From the Georgia Institute of Technology arrives FingerSound, a smart ring that recognizes thumb gestures and converts them into words and numbers.
Cosmetic surgeons have always fielded seemingly odd requests to recreate body parts from celebrities: Angelina Jolie’s lips, David Beckham’s calve, or perhaps Salma …
As early as 2009-10 , researchers were looking at Twitter data mining as a way to predict the incidence of flu. At the time, the H1N1 virus, or “swine flu,” had made the jump from …
A team of researchers from Tel-Aviv University developed a neural network capable of reading a recipe and generating an image of what the finished, cooked product would look like. …
Not only is air pollution bad for our lungs and heart , it turns out it could actually be making us less intelligent, too. A recent study found that in elderly people living in …
As we showed with HUBOT , we can use new technologies and robotics to make our work more enjoyable, interesting and humane. Aside from our speculative jobs, a lot of robotic …
Rooftops covered with grass, vegetable gardens and lush foliage are now a common sight in many cities around the world. More and more private companies and city authorities are …
A flock of drones that fly like birds, drifting blocks of concrete, a choreography of opening and closing flowers. The work of Studio Drift is challenging the distinction between …
What is the first thing that comes to mind when you hear the term 'biohacking'? Perhaps you are now thinking of a bunch of kids sitting in their kitchen with a DNA kit, (wannabe) …
In science fiction and popular science, 2030 is often suggested as the year in which our planet will run out of oil. Similarly, 2100 will be the year that, according to …
Tropical forests are one of the world’s largest carbon stores and they help regulate the global climate. But they’re being erased at a terrifying rate. Deforestation claimed an …
Last week I was strolling through the aisles of the supermarket when I heard a buzzing sound coming from my pocket. I looked up from my cart and saw it was a message from …
There are more than 1.4 billion cars in the world today, and that number could double by 2036 . If all those cars burn petrol or diesel, the climate consequences will be dire. …
The digital world has been creeping closer to your face. Was a time when a laptop was about as personal as you got with a computer. Then came smartphones, and a few years later, …
Looking at evolution, we see that there’s always a next nature. Nature changes along with us. How will that influence our way of life in the future?
The times where memes were geeky and funny, somewhat disturbing images have been over for years. Even a simple frog such as Pepe is not innocent anymore. Memes were hijacked by …
Today our human impact on Earth is humongous. Climate change, plastic oceans, mass urbanization and deforestation. Scientist recently calculated the technosphere now outweighs the …
A team of researchers from Freiburg University has developed an artificial muscle that may result in improvements in medicine, prosthetics, and implants.
Finding realistic solutions to the humanitarian and environmental issues in the textile and fashion industries.
AUSGANG Studio combines art, technology, and living materials to tell stories of our world's trajectories.
Coming across an image like this, makes one wonder at first: is it a giant punch-bag? Some sort of soft water-drop-sculpture? No, it is the Emergency Outdoor Survival Cocoon , …
Paradise by the Laptop Light is a visual power event with short films, speedlectures, special guests and one laptop. It will be held on 23 November 2007 16:30, as part of STRP Art …
Written by Joop de Boer from Studio Golfstromen - strategy, planning and design on the city. In the virtual world 'Second Life' everything is possible. That's most obvious in the …
The Wilson Quarterly profiles the in January 2008 departed traffic engineer, Hans Monderman , of the "less is more" school of traffic control: " (...) Previously, Monderman, like …
Rule #1: A robot may not injure a human being or, through inaction, allow a human being to come to harm. Remember Isaac Asimov's classic three laws of robotics ? Surely thats …
Humans have domesticated animals for thousands of years. The earliest known evidence of a domesticated dog is a jawbone found in a cave in Iraq and dated to about 12,000 years ago …
(Extracted directly from Pink Tentacle , thanks!): Researchers from Japan’s ATR Computational Neuroscience Laboratories have developed new brain analysis technology that can …
Earlier we reported software that predicts how a wine will rate in reviews even before it is made . Now, for puber-geek delight, lets try that for women. Tel Aviv University …
Unlike many people fear that computers will overtake humans, Ray Kurzweil states that robots will merge with humans, robots the size of cells which can do the job way more …
" It took just 10 minutes for a dozen prairie dogs to outwit the creators of the Maryland Zoo's new $500,000 habitat. Aircraft wire, poured concrete and slick plastic walls proved …
Susan Blackmore studies memes: ideas that replicate themselves from brain to brain like a virus. She makes a bold new argument: Humanity has spawned a new kind of meme, the teme, …
The fifth category encapsulates the products that are ‘naturally made’. Arguably, here the natural claim is the most convincing. Think eco-tomatoes, bottled mineral water from a …
If a tattooed pig is a bit too much for you, why not go for a tattooed goldfish? They bring you lost of luck and are available Chinese characters such as “Wealth, Dragon, …
What are these people doing? Of course! They are tattooing a pig with the pattern of the luxury bag brand Louis Vuitton. For those who want something more special than the mundane …
Once upon a time there were two global soft drink brands. One old brand and another, slightly younger. The older one positioned itself as The Real Thing as it entered the market …
Augmented (hyper)Reality offers a glimpse of an alternate universe, with augmented reality cranked up to the next level.
So you’ve seen the peak of the Mount Everest on tour ? Descended the bobsled ride of the Matterhorn in a Disneyland ? Think you’ve seen it all? Now come and see The Berg in …
Alright, we were mistaken. Money isn't virtual after all. A recent TV commercial of a Greek bank shed light on the issue. Your money lives, is anthropomorphic and inhabits an …
Avatars, almost every internet user has at least one of them running around somewhere on the web. We control then in numerous games and forums, but do they also control us? …
As a child, I already saw some great tiger potential in my cat and some shark-ish attitude in the behaviour of my goldfish. Personally, I think that since we started domesticating …
Designer Guus Baggermans was quite annoyed by the clumsy impoliteness of current vending machines, that typically require you to enter some abstract number to select your drink or …
By analyzing billions of phone calls, researchers at Scandinavian telecom company Telenor , mapped how social connections between people – measured partly by how often they called …
The way down was slow and somehow greasy. Total darkness surrounded them. Gill turned on the car radio and the LED's lit up their faces in a green pulsating glow. 'Jovi Rocks!', …
In the last few decades there have been numerous films that take the struggle between mankind and its increasingly intelligent and autonomous technology as a leitmotif. Ranging …
When searching for Next Nature in the world around us, one does not necessarily have to look at the present. The science fiction novel Jurassic Park, written in 1990 by the …
Carbon fiber and aluminum are so 2009. This year's best bicycling model is made out of bamboo and hemp. A new generation of manufacturers are coming up with some of the most …
Welcome to the 11 part series The Golden Rules of Anthropomorphism and Product Design. In this series, we will be examining how designers can better integrate human-like forms or …
Growing meat in the lab, rather than slaughtering animals, could become a viable alternative for people who want to cut the environmental impact of their food consumption, but …
Designer Revital Cohen imagines a future where life-support machines are replaced with life-support animals. In this scenario, a transgenic lamb is allowed to frolic in the fields …
As they went down the elevator shaft, going deeper underground, neither Nada nor Manko spoke a word. To Manko it seemed to take forever. In his mind, he went over the long …
Many things have been rumored about the artist called Manko since he vanished about a year ago. Some even went so far as to claim he had died. So it was all over the news when …
Until now we've seen the types of brain-computer interface where the human has to put on some sort of bulky hat full of wires to control a machine. It won't be like that for long: …
What animal is so naive to come into this world as a naked and crying infant, completely vulnerable, helpless, and an easy prey for any predator? Newborn lamb or giraffe’s babies …
The Center for PostNatural History doesn't house the dinosaurs or dioramas of your run-of-the-mill natural history museum. Instead, it's the first museum dedicated exclusively to …
It has been a trend for people to grow taller and taller during the evolution. When people get taller, they will need more energy, food and space. Since the human population is …
Japanese professor Hiroshi Ishiguro from Osaka University has quite a track record of threading the uncanny valley. Remember his Doppelgänger Robot and Geminoid Female ? His …
Welcome to earth, #7,000,000,000! Hope you like the #anthropocene. Learn more: http://bit.ly/se1SQc
Associate professor Anne Trubek argues that handwriting will soon be history , because writing words by hand is a technology that's just too slow for our times, and our minds. A …
Has nature become a fairytale or do we want it to be one? In their installation The Clockwork Forest , artist collective Greyworld seems to opt for the latter. The work of art …
Researchers at Stanford and the J. Craig Venter Institute recently created the first complete computer model of an organism. The simulation models the genome and life processes …
Twenty-first century society draws from a world that is less determined by objects and increasingly shaped by connectivity. The clear either/or distinctions that formerly informed …
Intuitively we expect the 100% organic green clothes to be more environmental friendly and sustainable, but is this really the case? The color of cotton is brown by nature, not green. Most manufacturers use chemicals to bleach and paint the cotton.
Another step in the fusion of the made & the born: Researchers at Harvard University managed to make an artificial jellyfish using a sheet of silicone and rat heart cells. The …
Is the neon green tetra GloFish soon to be the florescent, transgenic terror of America's waterways? The internet hype machine has repeated ad infinitum the Washington Post's …
The boundary between humans and machines is slowly but steadily blurring. The Immortal is a machine which exists out of several life-support machines connected with wires and electric cords.
Google becomes the authority on existential questions about aging.
Egyptian authorities detained a stork last week on suspicion of espionage.
Farmers in the US are producing fuel and high-quality fertilizer from their cows' manure.
Peoples attitudes online are wholly different from their behaviours in real life
There are robots that look like people, and then there are robots, like the Ecobot III, that look nothing like humans but have our same biological needs: they have to eat, digest …
You’ve heard about peak oil, but what about peak automobile?
A stem cell experiment with mice may one day mean that same-sex couples could have bio children.
Artist Filippo Minelli aims to point out the gap between the reality we still live in and the ephemeral world of technologies.
New citizen science games are bringing gamification to serious issues.
3D printed organs are on the way. Could they be designed to be aesthetically appealing?
In 100,000 years human beings might look like a manga character: big intense eyes, high forehead, large head, straight nose, more pigmented skin, and perfect symmetry. “There will …
Floris Kaayk, artist and fictive documentaries maker, confronts us with the impossible.
Researchers engineered poplar trees for an easier production of paper and biofuels.
Kids learn the basics of electric circuits while playing with clay.
Most people nowadays know more logos and brands than bird or tree species. Go test your own knowledge. Take a look at the leaves and logos above and see how many you can identify without looking them up.
A tool that could turn the arm into a touch screen display.
As technology evolves, what today seems like science fiction may be the job market of tomorrow: 11 professions of the future.
There seems to be a high demand for the ability to self-diagnose. Consider Scanadu , a company developing a medical device for self-diagnosis, has become the highest funded …
Objects that normally used to surround us became more and more virtual, radically changing the aspect of our workplace.
Researchers from UC San Diego announced that they have developed 3D print tiny microrobots in the shape of fish able to detect and remove toxin from liquid.
Researchers are working on artificial organs-on-chips will be used for drug development.
To counter the sitting dogma, design firm RAAAF and artist Barbara Visser created a dynamic office concept, entirely based on movement and leaning.
Time ago we wrote about the fact that US Food and Drug Administration was considering whether to approve the first genetically engineered salmon. We have a verdict: from now on …
Last April, a Chinese group of researchers published a paper that set the scientific world ablaze in a fierce debate. The paper was about their attempts to edit the DNA of a human …
Thanks to the antenna implanted in his skull, Neil Harbisson can hear images and paint sounds.
An he hi-tech Swedish office block implanted a microchip under the employees’ hand skin.
In these modern times a traditional first aid kit won't do anymore. As the world around us innovates, our needs in case of an emergency change as well.
A group of students at the MIT Media Lab are working on an electronic textile that might help us interact with people more easily.
Recently 338 sharks in Western Australia subscribed to the microblogging service. They are now tweeting out where they are.
The SkinBook is made of synthetic skin that allows beginner tattooists to practice their skills.
Australian programmer started a social experiment called “Twitch Plays Pokémon”. Over a Million People Play Pokémon in Social Experiment
According to the Wikipedia page 'Wikipedia: Getting to Philosophy', more than 94% of all articles will eventually lead to the English article "Philosophy".
An AI was intended to improve human-like experiences in regards to the company’s customer service chatbots, but has fallen into a suicidal depression instead.
Pokémon Go is slowly taking over our planet. People know more Pokémon than bird or tree species. However, avid players will have noticed that some of the first-gen Pokémon are not available in the game yet.
China's government fabricates about 488 Million social media posts every year as a strategy to distract from critics to the regime.
After reports of Samsung phones causing serious damage, plane delays and even hospitalization, the company made a first recall. However, the new phones were still bursting into flames.
A recent research reveals that the next extra nutritious ingredient may be the liquid produced by cockrach mothers to feed their offsprings. Are you willing to try it?
Scientists managed to create what every woman has been dreaming of: a second skin to reduce wrinkles and tighten the skin.
Part two of a ten part series exploring the design of an invisible technology: money.
Facebook provides a new tool for suicide prevention
The Cochin International Airport is self-sufficient thanks to its solar power plant.
Researchers have the developed the EQ-Radio: a tool to read people emotions from a distance.
Watch a fly land on the kitchen table, and the first thing it does is clean itself, very, very carefully. Although we can’t see it, the animal’s surface is covered with dust, …
The Hyperloop is a future transportation means that is safer, faster, and cheaper than current forms of mass transit.
All it takes to steal $60million worth of cryptocurreny is to create a child DAO. Sounds too good to be true...
Researchers created solar cells as light as a soap bubble.
Meet the firefighter drone, she is the best at extinguishing fires and keep every species safe!
The Smell of Data alerts Internet users in any case of data leakage and communicates digital hazards by means of smell.
Why would you stick to an elbow, a wrist and five fingers if you could make anything? This guy got a game-inspired bionic arm.
Extinct European bisons are being reintroduced in parks. But what makes a national park?
Utopian off-grid ReGen Village produces all of its own food and energy is being implemented in Almere.
In the last months we've been witnessing a refugee crisis of huge proportions. More than a million people crossed the sea to flee violence in Africa and the Middle-East. Together …
Terrapattern is a search engine that gathers similar elements of satellite imagery, giving surprising results.
Will a small step for Ramazzottius Varieornatus be a giant leap for mankind?
Last week The Hague hosted a festival dedicated to contemporary experiments in music, art and digital culture.
In 1916 the artificial womb made its first appearance on the big screen in the movie "Homunculus" by Otto Rippert.
The movie The Matrix brought ectogenesis to the public eye.
A Swedish woman who had her uterus removed due to cancer in her twenties gave birth to her own child as the world's first person to undergo a uterus transplant. And the donor? Her own mother.
Biometric technology replaces passports in Australian airports.
Bionic leaf fertilizes crops to make them weigh 150 percent more
Royal College of Art graduate Dani Clode reframed prosthetics as extensions of the body, rather than replacements for missing parts.
The complicated system of a female menstruation cycle was reproduced on a computer chip for the first time.
This floating gym harnesses human energy to sail down the Seine River in Paris.
Offshore renewable energy resources, such as floating solar arrays, have begun to pop up around the world.
The Juncao Technology Project makes it possible to grow edible and medicinal fungi on chopped grass or herbal plants.
The robots are coming! They’re getting smarter, cheaper and more reliable. How long will I have my job before a robot steals it? The industrial revolution made muscular power …
Warehouse management practices and processes evolved with the time, but they’ll need to maintain their adaptability to accommodate Industry 4.0.
Do we treat our technologies with more care and sentimentality these days than we did in the past?
POP is an all-in-one solar energy system that hold visible benefits for humans.
This is post number three of our serie 'Robots at Work'. In this episode we present you five jobs for facilitators, the ones who love to work with technology.
This is post number four of our serie 'Robots at Work'. In this episode we present you five jobs for entrepreneurs, the ones who love doing big business.
This is post number five of our serie 'Robots at Work'. In this last episode we present you five jobs for the extraordinary, the ones who won't let themselves be categorized.
The Texas Heart Institute researches in the field of organ transplantation. With the “ghost heart” — an heart organ scrubbed clean of all its former cells, the researches are on the verge of creating a sustainable and effective way of transplanting organs.
Shazam for Plants app lets you catch around 400.000 plant species left on our planet through the lens of your smartphone.
MIT Media Lab developed pasta programmed on a computer.
Drone made to rescue in bad weather condition in open waters.
Memphis Meats reveals world’s first lab-grown chicken.
It takes years to design a new banknote, having hundreds of people working on every little detail, all done under the watchful eye of governments and professionals. However today, …
To some extent, it's a chicken-and-egg question: Are you unable to think about things you don't have words for, or do you lack words for them because you don't think about them? …
Recent years have proved that if you want to look for which countries are adopting innovative digital governing solutions, you don’t look at the usual tech suspects like the US or …
Babies' needs aren't complex. And yet, they are. Over the years, parents have found some tricks to ease their babies as well as themselves. Taking a baby for a drive to make them …
A Swedish shopping center is bucking the trend of mindless consumption. At the ReTuna Återbruksgalleria every product is made of recycled materials.
Earth’s oceans have seen better days. They’re inundated with plastic waste, both whole single-use plastics and tons of plastic microparticles that find their way back into our …
Emoji, Skype, Selfies - can these communication technologies close the generation gap? In part, yes! Young people are teaching senior citizens how to use technology, and it’s …
Death certificates and commemorative plaques aren’t something you’d normally associate with a glacier. But that is exactly how Iceland recently mourned the loss of 700-year-old …
Robot Sophia is pretty much the international face of the ‘modern robot’. Sophia is the Audrey Hepburn-inspired humanoid robot who stands out for multiple reasons. She is the …
As the ills of factory farming become more pronounced, people are increasingly gravitating towards vegetarian or pescatarian diets. Besides producing a large percentage of our …
With most of us stuck at home because of lockdown, for the singles around us intimacy may have turned into a distant dream. Could we find our salvation in technology? And what …
With great pleasure we announce our plans for 2021-2024: ‘Hello, Superorganism’ . Our human presence has a huge impact on the planet; plastic in the oceans, climate change, mass …
In conversation with Canadian researcher Suzanne Simard, inventor of the Wood Wide Web.
While aviation accounts for 2.4% of all emissions from fossil fuel use globally, two-thirds of the sector’s warming effect depends on something other than its CO₂ emissions. And …
Dig a teaspoon into your nearest clump of soil, and what you’ll emerge with will contain more microorganisms than there are people on Earth. We know this from lab studies that …
Dune offers a useful allegorical narrative of the “scramble for Africa”, which saw European empires carve up the continent into colonized powers.
What is the metaverse and to what extent should we believe that the vision being presented to us is really going to be central to our daily lives?
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Is it possible to imagine other earthly stories? Can we conceive of other ways of living among different species? This exhibition explores these issues with the help of a …
Global warming is a big challenge for warm-blooded animals, which must maintain a constant internal body temperature. As anyone who’s experienced heatstroke can tell you, our …
Most people think of mammoths as the iconic woolly species from the last Ice Age, which ended around 12,000 years ago. But mammoths originated in Africa around 5 million years …
In 1972, the Club of Rome published The Limits to Growth, a report about the future of the world. They described the limits of the world’s resources and what it is capable of …
The Earth BioGenome Project is aiming to create a database of genomes of all organic life on earth within 10 years.
Living Carbon enhances natural traits in plants as a solution for stabilizing the climate by increasing the efficiency of the photosynthesis process.
Fishfarming , or aquaculture has been the fastest growing food-sector for decades. This is nothing to be surprised about: fishing as a practice has been in existence since the …
The music industry is witnessing drastic changes. With the emergence of artificial intelligence technology, no industry has been left untouched and there are broad discussions …
Beyond being little umami bombs, mushrooms are: protein-packed and nutritious. But here's the pitfall: their cultivation can be pricy. Especially gourmet mushrooms such as …
Researchers used genetic information from an extinct mammoth to create a lab-grown meatball.
In a ground-breaking discovery, researchers at the University of Pennsylvania have achieved to produce insulin out of lettuce. There's no need for needles and injections anymore, …
Researchers hope that 3D-printed, biodegradable mussel reefs help the growth of mussel banks.
Controlling devices with your mind. Unreal? Think again. Brain-computer interfaces have been changing the game in healthcare, gaming, and accessibility lately.
10 design requirements to fully immerse ourselves into the 21st Century—in which technology makes our world richer, not poorer.
Food design gives us a taste of innovation. It visualizes, speculates, challenges and problem-solves.
1. THE FUTURE IS PRESENT Design Museum Danmark How will contemporary design define the future? THE FUTURE IS PRESENT grasps the very essence of Danish artistry of material …
What if an ancient mammoth found herself resurrected by humans into our modern age?
Today the Entry 2006 exhibition opened in the coalwashe building, Zollverein. For 100 days 'perspectives and visions in design' with over 300 exhibits from more than 20 countries …
Nature is not what it used to be. Or at least that is what we may think, when we look at the way humans and their technologies have treated nature. When we speak of "nature", …
Man's ability to control illumination is magical in itself but is seldom experienced as such because light switches are purely functional and generally don't stir up imagination. …
While the Freedom tower , replacing the WTC twin towers, is being constructed at ground zero, I still enjoy looking at some of the earlier submitted proposals. They tend to be …
Paradise by the Laptop Light is a visual power event with short films, speedlectures, special guests and one laptop. It will be held on Friday 23 November 2007 16:30 - 18:00, as …
Alright, we can agree most of old nature has been altered by human activity. We're not just talking rain forest, icecaps and genetically modified fruit and kittens . Now you might …
"While battling the forces of nature, man has become more and more independent of physical conditions. At the same time, however, he has become more and more dependent of …
Ambient Biomedia is an investigative project about using living beings, in particular plants, to display human lifestyle problems information. The working principle of our systems …
So you thought the 'consumption of illusions' was a typical digital world activity of second life residents and gaming addicts? Never underestimate virtuality in everyday life. …
TERRACINA, Italy: Before Michele Assunto hauls in his fishing net from the banks of a reed-lined canal here, he uses a pole to push the garbage out of the way. "They really need …
So you thought that animated Pixar Lamp from the movies was just a fantasy? Not anymore. Luxalive is a prototype of an reading lamp that moves according to the character of its …
At the beginning of the computer era, many objects and experiences from everyday life were transferred to the digital environment in order to make technology understandable (think …
'The LED Dog Tail Communicator' is an initiative of James Auger and Jimmy Loizeau, and it is part of the larger 'Augmented Animals' project. Its focus points to technological …
Get Wickd (props for the name boys – totally wicked!) is a tech-fashion brand that sells basic clothes with barcodes that can link your mobile phone to any page on the web, from a …
Computerworld reports a big spam-spewing botnet, that was shut down a few weeks ago, has been resurrected and is again under the control of criminals. The "Srizbi" botnet returned …
We have lived for 200 years in a growth economy . That's more than a lifetime, so it is no surprise people tend to think of economy as infinitely growing. Herman Daly , who …
In the nineties laser printers revolutionized graphic design. Currently 3d desktop printers are revolutionizing industrial design. Next we will be printing buildings and …
Little over a week after the Large Hadron Collider (LHC) became operational it broke down. As the world's largest particle accelerator isn't working, c omputer simulations are the …
DNA related tools, once expensive and restricted to research and crime labs, are rapidly becoming affordable. Like GPS – once a high-tech wonder now turned into a everyday gadget …
Every medium was new oneday . This point is beautifully illustrated in the movie Quest for fire ( La Guerre de feu by Jean-Jacques Annaud, 1981), a must-see for Next Nature …
When a bird builds a nest, we call it nature, but when a human puts up an apartment building, suddenly it’s culture? As if the dividing line between nature and culture wasn't …
Is it a cynical gesture to glue a 'Stop Continental Drift' bumper sticker on your gasoline addicted car? Absolutely. Yet indirectly it also criticizes the romantic …
://nextnature.net The expanding research culture of synthetic biology demystified in this TV item on the International Genetically Engineered Machine competition . Via Posthuman …
Mark Menjivar created a series of portraits of people across the United States, by taking pictures of their refrigerators content. Quote: "For three years I traveled around the …
This speculative self-sufficient, carbon-negative floating city design by the Japanese Shimizu Coorporation immediately reminded me of the post-apocalyptic science fiction film …
Professor Hiroshi Ishiguro ( Intelligent Robotics Laboratory at Osaska University) has done it again! This time in coöperation with robot-maker Kokoro Co. Ltd . Objective: to …
It took some years of evolution to turn sex (between different sexes) from a stricly functional activity attuned to reproduction, into the recreational activity it is primarily …
They say “An apple a day keeps the doctor away”, but now we wonder what this keeps away, the Grapple , a hyperfruit that "Grunches like an Apple. Tastes like a Grape." The …
As our everyday living spaces are packed with electronics and become increasingly sentient, we might one day wake up in a house that knows more about your family's state than you …
At the end of every cold winter there is a debate in the Netherlands on whether the forestry service should feed the oxes, horses and deers grazing the Dutch nature resorts. The …
With all the new health management gadgets available becoming more and more widespread and cheap (even in the form of free iPhone apps), your brain, your stomach, your heart, …
The Catholic Church is not exactly renowned for its progressive attitude towards technological progress. Just think of the belligerent attitude the Church still has towards …
Last month we discussed how the vacuum played a big role in Manko's life since he lost his right leg. Soon he developed this idea further, beyond the mere notion of extensions …
Hippopotamus: a 2,5cm-long tablet-shaped nonliving chewable animal, member of a multi-species flock known as the Animal Parade, which tastes like fruit and is found in little pill …
Nature is an agreement. Just like the nude beach. Here you keep your breasts and your crotch covered, There you drop everything and act like it is the most ordinary thing in the …
The human body is increasingly recognized as a biometric source of information for a wide spectrum of issues, including security, psychopathology, personality and health. Earlier …
Last week, the U.S. Navy announced that four of their “ REMUS 100 ” unmanned underwater vehicles sailed off-radar and stopped responding to commands. The ‘bots were part of a …
Using energy is not a social activity. Every electrical device we use has its own carbon “foorpint” which, in excess, can harm other living beings. How and to what extent you’ve …
There are many advantages of bare feet sporting: better motion control, more feeling in your feet and direct floor contact, etc. In this way you are more grounded and more aware …
What happens when next nature dreams of old nature? Such is the case with extinct animals that have ever come in contact with humans, particularly the dinosaurs, our own …
Rayfish Footwear, a company based in Thailand, has recently produced what may be the world's first genetically modified stingray. This ray exhibits an unusual, colorful pattern …
If you happen to be in the neighborhood you might want to attend the Next Nature lecture I will be throwing at the Transnatural symposium this Saturday 13-03-2010 at the Trouw …
City rats, it seems, prefer the same foods that humans do: Greasy, fatty, sweet, and salty. Although rats are usually seen as the billy goats of city life, ready to chow down on …
We normally think of polluted water as the source of disease, not the cure for it. The Gowanus Canal in Brooklyn, affectionately known as the Super Fun Superfund , is one of the …
Manko was completely cut off from everything around him, virtually dead, buried alive inside of his own body. He remembered Zero's advice not to panic, but to no effect. He had no …
Mega-agro-biotech corporation Monsanto recently denied that insects have developed resistance to their patented Bt corn . Injected with a bacterial gene toxic to corn rootworms, …
Mediamatic is hosting a pop-up urban mushroom farm in the middle of Amsterdam. Rows and rows of shiitake, oyster, and the elusive almond-flavored Agaricus subrufescens are …
Japanese researchers are currently working on cloning a mammoth, and plan to produce a fluffy new prehistoric calf within four or five years . The bucardo, an extinct subspecies …
Protei is a sailing robot that's designed to clean up oil spills without human assistance. After sailing upwind, the bot drifts downwind, zigg-zagging across the surface to absorb …
In the film Plastic Bag , the title character spends a lifetime (or more) on a quest for a creator not even aware of his existence. A stunning short by Ramin Bahrani, director of …
Adapting video games to real life has become a fairly common, jokey way of exploring the games' surreal aspects. I saw kids with balloons playing Mario Kart on my college campus, …
The earth operates on a 24 hour cycle, and so do humans. For most of history, we didn't have much choice in the matter. However, in the absence of visual cues light sunlight, some …
Could you imagine yourself having QR-code freckles, or a chlorophyl skin? Dutch artist Marcia Nolte visualises these kind of speculative scenarios in a very non-spectacular yet …
During the coming weeks, we will present a selection of our favourite pages from the Next Nature book . To kick the series off, we’ll start with a spread about hypernature; the …
During the coming weeks, we will present a selection of our favourite pages from the Next Nature book . This week the second one in this series: Google Nature. Imagine you are an …
Researchers have developed genetic manipulated mice, with extra smell receptors that make them highly sensitive to the smell of explosives. Scientists hope to use these mice in the future to discover land mines
For past entries and an introduction to the 11 Golden Rules of Anthropomorphism and Design, click here. Think about a spoon. Now think about a spoon with a face. What do you …
For past entries and an introduction to the 11 Golden Rules of Anthropomorphism and Design, click here. When a product imitates animal behavior, the strict social rules …
Do you ever miss being able to smell the woods in an online travel journal? The odor of a new leather jacket in an online shop? Or perhaps you just couldn’t find the words in an …
Some desert animals, like the kangaroo rat, get through their lives without needing to drink even a drop of water. Now, a Japanese design company aims to make humans just as …
A new study on the effects of cholesterol on the life span of Caenorhabditis elegans, a tiny worm often used in experimentation, resulted in some surprising finds. The life span …
An showcase of what we are currently capable of installing in human beings.
Trials for new drugs hold promise for a "cure" for female boredom in the sack.
Scientists claim to have discovered a “prehistoric version of Facebook” used by ancient tribes to communicate with each other.
Algae as the future alternative fuel for the human body.
Invisible ear implants for listening to music, getting directions, and recording conversation.
Food companies are hard at work inventing processes to make luncheon meat look "deli fresh".
Need a password that you'll never forget and can never be stolen? Try storing it in a pill in your gut.
Having 50% more “conscious lifetime” might sound like an appealing proposition to anyone with a hectic schedule. This could be achieved not necessarily by living longer, but by …
A new technology enables us to produce electricity from living plants at practically every site where plants can grow.
Buq are electronic life forms that shift the experience of the street scape from the primarily visual to a more auditory experience.
Rubber band distortions lead to discovery of a new shape called hemihelix.
Facebook data science analyzed what happens to our virtual life when we fall in love.
Filtering sea water to drinkable fresh water is no longer science fiction.
Govedare paints the human impact on natural environments, showing how nature has become a subset of culture.
In 1981 the idea of what we call smartwatch was nothing more than a funny joke.
Science Fiction taught us to think of robots as human-like beings, yet the robots that actually make it into your home are more likely to look like furniture.
The Pavlok wristband gives its wearers an electric shock if they fail at hitting work deadlines or completing fitness goals.
Indium gallium arsenide couldbe the material of the new super computer chips of the future.
Prof. Patrick Brown developed a meatless burger that look and taste like meat, made out of plant ingredients.
A new Kickstarter project aims to bring the forest into Times Square.
Researchers from the Massachusetts Institute of Technology have developed a tiny wireless trackpad that could easily fit on your finger nail.
How cities will function when there are more robots than people working in factories, everything is intelligently interlinked, autos drive autonomously and drones deliver the mail?
A wearable lighting device that changes color and shade according to movement, facial expressions, weather and mood.
Scientists think the laws governing the structure of galaxies in outer space are the same laws underlying the growth of cities.
Robots can already read, talk and reason. Yet, they do not seem to have found limits to their artistic skills either. Meet DOUG_1, first the drawing robot.
British company BioCarbon Engineering developed a new ingenious way to exploit drones: reforestation.
An exoskeleton chair that allows the body to move freely.
Facebook introduced its solar-powered drone project aimed to provide internet access to rural areas.
The acronym that keeps Europe awake at night is TTIP (Transatlantic Trade and Investment Partnership), a trade and investment deal that the EU is negotiating with the US. From …
Turning a normal stroll through the supermarket into a psychedelic dream (or nightmare) of algorithmic pareidolia.
This augmented reality helmet allows the wearers to see all around them without having to turn their head.
While the Watson technology is exponentially increasing its processing power on an annual basis and steadily moving from answering trivia questions, to cooking advice, onto medical advice, it is about time we confront it with the million dollar question: "Watson, what do you want?".
Researchers discovered a protein that can be used to produce the first ice cream that melts more slowly that the normal products on the market today.
Dutch researcher and entrepreneur, Willem van Eelen, has died in Amsterdam. For more than half a century, Van Eelen relentlessly researched and promoted In Vitro Meat.
Droog Foundation and Next Nature Network invites you to join the conversation about Intimate Technology: April 23, in Amsterdam.
This potentially revolutionary device includes LED lights and temperature sensors to provide medication directly to the wounded section of the skin.
Dr. Garth Webb, an optometrist from British Columbia, has invented the Ocumetics Bionic Lens : lenses that after being implanted through an eight minute surgery, improve eyesight …
In the near future he ability to see through things won’t be a dream anymore with this infrared smartphone camera.
A special absorbant film that require no soil may be able to grow plants more efficiently than soil farming.
Solar eclipse may impact power supply due to increased use of solar panels
The Wood-Boring Wasp inspired scientists to create a new robotic needle which will be used in brain surgery.
A severely injured tortoise was saved by a team of doctors thanks to a 3D printed shell.
The latest researches showed how AI can recognize human faces even if pixelated and meant to be incognito.
The bacteria that degrades and assimilates plastic.
C-sections have an unexpected side effect on human evolution. Newborn heads are getting bigger, while the mothers birth cannals are becoming smaller.
We already recognize faces in our cars, now it is time for our cars to recognize our faces.
Can we have pretty power stations? The design of power stations is becoming more appealing.
Would you vote for an artificial intelligence to govern our society?
A laboratory is developing a synthetic dog that will be used for surgery trials, saving many canine lives and changing the veterinary world.
Loneliness is a major social issue and can only be 'cured' with real world interaction.
Since plans for conquering the Red Planet are becoming more serious we should get acquainted with the possible view from up there.
Researchers at the John Hopkins University School of Medicine succeeded in hooking up a prosthetic arm to the human brain.
Next Nature Habitat premiered at VR Days Europe in Amsterdam last weekend.
Newly grown rainforests can absorb 11 times as much carbon from the atmosphere as old-growth forests, a study has shown.
The new mythical creature hunting our imagination is called Slenderman and is born on the internet. But who is this being and how it came to be? It may just be the modern version of a much older myth.
Researchers discovered a way to store data in five dimensions on a nano structured glass able to survive for billion of years.
This automated store in Sweden doesn’t have any human employees, only a smartphone app.
While we can’t just leave the coast permanently without upsetting the delicate balance of this new environment we created, we can take better care of it to ensure that it is around for years to come.
A canadian entrepreneur is trying to help reduce plastic pollution by building a village made out of plastic in Panama.
Two robots opened the show of Chanel during the Paris Fashion Week of 2017. Well robots, two models dressed up like humanoid robots entered the catwalk. Is Chanel going Next Nature?
New York City decided to definitely say goodbye to neglected payphones and replace them with Wi-Fi hotspots.
In 1978, the world's first test-tube baby was born, her name is Louise Brown.
A San Francisco-based start up discovered a way to "brew" milk that has zero hormones, antibiotics, steroid or lactose inside, and a longer shelf-life.
It should come as no surprise that artificial intelligence naturally extends into the way we work. Let's look at how AI changes the way we relate to work.
Internet of Things installation reflects on the adjustments we make to the environment in our attempt to save time and be more productive.
BladeRanger might have found the ultimate solution for solar panels cleaning putting drones and robots together at work.
We had a wonderful first run of the ECO Coin during DGTL festival in Amsterdam.
Last weekend the ECO coin ran its second living lab at Welcome to the Village festival. We wanted to experiment with making our new sustainable currency more social and test our new ECO coin payment system.
New heat-reflective material signs the end of air-conditioning use.
To explore deep sea Standfort University developed OceanOne: a humanoid diving robot, which at the same time creates a simulation of the underwater experience on land.
Company Blue Frontiers wants to build 7.500 square meters of floating city made up of linked platforms, starting 2018. They hope to complete it by 2020.
As a focused assembly worker, you are a real go-getter thanks to your smart tools. Wearing smart factory goggles and using a transparent LED screen, these give you direct …
Scientists gene modify ants in order to find out more about their social behavior.
NNN fellow Govert Flint discusses Enrichers in Frame magazine.
Our Next Nature Habitat VR experience has won the Sweden International Virtual Reality Award in the category Best 360 Video!
In 2017, a hoverboard can fly 164 feet above earth and able to hover over the Atlantic Ocean.
If you’ve watched clouds roll by, you know wind moves more steadily in the upper atmosphere. Turbines just can’t reach high-altitude wind energy. Kites can!
Sensor specialists recently developed a sensor that mimics the mammalian eye.
Craftsmanship is generally very appreciated, but it takes a lot of time to master a craft. Therefore, as a robot coach you train - you guessed it, a robot - to transfer your …
A new contraceptive has appeared on the horizon, bringing the prospect of an alternative form of male birth control one step closer.
We are pleased to announce the launch of the Next Nature Memory Game. Now available in our web shop, it playfully explores the shifting borders between biology and technology.
NNN organizes workshops using a physical Pyramid of Technology as conceptual tool.
As an organ designer, you develop genetic algorithms from which organs are grown to perfectly fit the recipient’s body, but also to meet the personal wishes of the patient.
The Punishment is an installation featuring a robotic arm that mimics a kid's handwriting perfectly, and repetitively writes "I must not hurt humans".
A Russian construction firm prints houses in 24 hours on site with their mobile 3D printer.
This seven-minute video, titled 'Slaughterbots', shows a future in which palm-sized autonomous drones commit untraceable massacres.
Dutch commercial telecom provider Ben recently launched an advertising campaign to sell smartphone plans by promoting disconnection.
The Bios Incube is a smartphone-connected biodegradable urn that turns cremated remains into a tree.
Scientists sent mango embryos to space lab in order to let them develop new genetic traits.
The Amazonian rainforest was already transformed over two thousand years ago by people who built hundreds of large, mysterious earthworks.
Using alternative reality as a cure for the socially excluded.
Are cities in their current form really the future of the human habitat? What is a next nature version of the city and how would it look like? In line with this perspective, NNN designer Hendrik-Jan Grievink led two workshops in Tokyo.
In effort of protecting and prospering their country, the Polynesian government has signed an agreement to realize the world’s first floating city.
An external device that helps you conceive, carry and raise a child. Too scary? Or extremely useful? It's up to you to decide, your virtual midwife is here!
The debate on the future of artificial biological reproduction is moving to Mexico. C Minds, an impact innovation agency that believes in ‘a 4th Industrial Revolution that brings …
If you've been dreaming of disconnecting and ridding your day of digital distractions, there's an island destination that would love to have you this weekend. Tonight, in one of …
A new test promises to fan the flames of ethical debate surrounding designer babies. For the first time, couples undergoing in vitro fertilization (IVF) could soon be able to …
After last year’s successful Living labs at DGTL and Welcome to the Village we started 2018 with another. This time with Booking.com at their Annual Meeting in January where over …
On January 17 1803, a young man named George Forster was hanged for murder at Newgate prison in London. After his execution, as often happened, his body was carried ceremoniously …
The appearance of “seen” has created a new phenomenon: opening messages partially, having a peek at the beginning of the message and assuming the rest so that the other person …
The season of giving has come and to make sure you can find the perfect gift for your loved ones we have brought together a collection of Next Nature inspired goodies. Whether you …
Neuroscientists at the University of California Berkely are building a device that’ll hack our brains so we can ‘edit’ what we feel and remember. It looks like we’ve drawn “ Total …
They say lightning never strikes twice, but it appears to be striking a lot more often in some areas of ocean than others. New research published in Geophysical Research Letters …
Tonight, Studio Drift is launching their debut museum solo exhibition at the Stedelijk Museum in Amsterdam: Coded Nature . As NNN Fellows , this Dutch duo is showcasing a …
Checking for new notifications has become a habit that is hard to resist. For some users of social networks it is a kind of an impulse. When receiving and opening notifications, …
We live in a world of fast or disposable fashion. This industry is increasingly impacting the environment due to the use of toxic chemicals, water and energy consumption, heavy …
Imagine you could communicate telepathically with a whale, listen to the WiFi networks in your environment, or experience smells through seeing color. Developments in technology …
Lining up plans for Dutch Design Week ? Once more, 2600 designers gather in over 120 locations during 450 events. So whether you're a local, new in town, or just passing through, …
For the closing event of Reprodutopia , a true meeting of minds took place as we discussed the social implications surrounding the future of reproductive technologies. Multiple …
If your Instagram feed is anything like mine, it’s littered with timelapses of injected lip fillers, Kardashian-promoted beauty products, and Story filters that “enhance” your …
This question is an excerpt from the Pyramid of Technology toolkit The first computers barely fit in your living room. This all changed with the introduction of the desktop …
Go forward to nature at the La Fabrique du Vivant (the Factory of Life), the newly opened exhibition at the Centre Pompidou in Paris. Exhibiting the recent works of fifty …
A recent lip filler trend blew up on social media. 'Devil lips' , or Octopus lips, have attracted divided opinion online. When the body modification hit Instagram, some spectators …
The food chain has always worked roughly like this: sunlight feeds plants. Plants feed insects. Insects and plants feed animals. Plants and animals feed people. Then …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here? Get in touch and …
Play is a core part of a healthy childhood , through which children develop social, communication, cognitive and physical skills. Children’s play adapts to its circumstances. …
The 14 Golden Rules of HUBOT are rules of conduct which must be followed and which everyone needs to hold each other to account. Themes like respect, teamwork, creativity, and …
In old nature, wood is grown in the forest. In the next nature, wood might be grown in a lab. Akin to the process of growing in-vitro meat , researchers in Velásquez-García’s …
This is #2 in our cyborg mythologies series, where we explore the cyborg as a historical being intertwined within mythologism, ancient religion and sacred iconology. A way to …
While Elon Musk may be trying to initiate efforts to colonize Mars, scientists on Earth are attempting to build an accurate digital twin of the planet to simulate in the future. …
What will the supermarket of the future look like? And what kind of food will you be able to buy there? That is what the Embassy of Food is researching. The production and …
The influence of humans on the earth can hardly be underestimated. Think of climate change, deforestation, and the decline of biodiversity. We are heading for a sixth mass …
For the last six months millions of Indian farmers have been marching through the national capital in an effort to repeal the laws that they believe would end guaranteed pricing …
A living lamp that you need to feed, a tapestry made of animal waste streams and tableware made from algae. Welcome to the wonderful world of biodesign.
Roman Krznaric's ultimate guide to radically change our perception of time and become good grand-grandparents
A lot of the ground we live on is polluted. More than a third of our soils are moderately or heavily degraded; heavy metals such as lead are increasingly found in urban soils, …
Scientists have discovered the effect of sunscreen on corals. We need to understand our impact on the world to understand its problems.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Many aspects of the current metaverse were already familiar 143 years ago.
In the summer of 2018, the European Court of Justice (that’s Europe’s highest court) reviewed a case and concluded that gene-edited crops should be subject to the same regulations …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
From the mythical fountain of youth to the many anti-aging procedures available today: humans have dreamed of internal youth for a long time already. At lot of us perceive aging, …
Biosequin, seaweed textiles, and microbe sunscreen: these ideas and more are marking the next wave of bio-innovators during the Biofabricate Summit 2024.
A significant milestone has been reached as the US Department of Agriculture has granted approval to a vaccine for insects for the very first time. An important breakthrough, …
Virtual news anchors seem to spread like wildfire across Asia. We've witnessed Xinhua present the news from China and applauded Lisa on becoming India’s first regional AI news …
Cleaning up ships' pollution is making the ocean warmer than expected. Less pollution means less cooling clouds, heating up the Atlantic.
Imagine helping nature restore itself simply by going for a run. In a fusion of fashion and conservation, London-based designer Kiki Grammatopoulos has introduced her concept …
Get ready to take your dining experience to literal new heights, soon we are able to enjoy high cuisine at the edge of space. French company Zephalto is introducing extravagant …
Embracing nature's ingenuity, designer Nicole Chrysikou harnesses the power of bacteria for her pottery practices.
Eddie Corwin studies beaver dams and ponds from satellite images in order to restore watercourses and wetlands, and establish nature reserves.
Meet United Matters, a London collective exploring how we might live in the future by blurring the boundaries between craft, science and technology.
Dutch photographer Koen Hauser blends parts of the human body with parts from anatomical models. You know, the ones you had in biology class and gave you this fine colorful …
The pictures of the Next Nature Biggest Visual Powershow , in Zollverein are now online! Powershowmaster Koert van Mensvoort and Claudia (most advanced robot in the world). …
TomTom and Vodaphone want to use mobile phone signals sent from traffic jams to gather real-time travel information. The data will be used for TomTom users to establish if roads …
Jayne Gackenbach, a professor of psychology and sociology at Grant MacEwan College, Canada has completed research which claims that video games alter the way the brain works. …
A flower arcing from a frosted pane of glass. Rigged with a breath sensor and connected to an internet packet sniffer, the flower is cued in to the wireless network flowing in the …
Chinese artist Xu Zhen created the monumental untitled sculpture depicted above (sorry I am such a bad photographer) for "NONO", a show without explanations or preconceptions, I …
The goals of "understanding humanity" and "humanizing robots" are tightly related to each other. Infanoid Project is trying to relate robotics to human sciences in order to …
What has a virtual world got to do with CO2 emissions? Electricity. Second Hype creator Linden Lab consumes an enormous amount of electricity on its 4,000 servers that support …
Earlier we discussed the Magical Interaction project, in which Joris van Gelder rethought the boring activity of switching on/off a light by transforming it into a magical …
The Vin Memoriam concept introduces a new ritual in the mourning process after losing a loved one. When a person has passed away, a small amount of blood can be processed into a …
What you are looking at, is the logo of perhaps the (in idea) biggest competitor on the search-engine market. It is beta-testing right now, but its demo video looks promising. Why …
Energy problem? Why not genetically alter bacteria to have them provide 'renewable petroleum'. Crude oil is only a few molecular stages removed from the acids normally excreted by …
It might just be my old nature mind, but I still find it a daily miracle: being able to walk into the bakery around the corner and trade a piece of paper – called money – for a …
Green bubbles? Yes, they seem to be everywhere nowadays. But for a change we aren't talking about those greenish marketing bubbles of the flourishing sustainability cult. …
Good morning anywhere in the world! Waking up is a problem (at least for 50% of the population). That's why alarm clocks exist; machines and devices are invented to solve …
So far, over-dependence on GPS devices has resulted in more inconvenience than actual danger, but earlier a U.K. woman sent her £96k Mercedes flying into a river, trusting the …
Always wanted to take that parachute jump from the airplane, but never dared to? Why not try an indoor sky dive? Less interesting view, but more floating time. You can jump in …
Now that we've recognized the internet as a living entity , we can begin to wonder what the internet is thinking of. Would it be possible to communicate? Ask questions? Read its …
In the Netherlands, there is a raging debate about a movie nobody ever saw. It seems that images have become so powerful, we don't even need them anymore to scare the hell out of …
The Nanputo Temple in Xiamen (Southeast China) is an oasis of quietness, religious practice and leisure for Chinese amidst the hustle and bustle of one of the fastest growing …
The 1966 science-fiction movie Fantastic Voyage famously imagined using a tiny ship to combat disease inside the body. With the advent of nanotechnology, researchers are inching …
Many people tend to eat too fast. As a result they do not receive signals from the stomach that they are in fact full. The result can be overeating and obesity . To encounter …
The fabrication of forests with artificial trees is one of the best strategies to stop climate change, according to scientists of the Institution of Mechanical Engineers . The …
This report on spooky showhost holograms appearing on national TV might be a bit of old news..., but I guess still worth posting. The word "hologram" CNN uses in this Youtube, is …
The eye passes on more information to the brain than the brain will process. In that sense, the brain functions as a filter. But on the battlefield the risk of neglecting …
To make way for modern tech terms such as BlackBerry, blog, voicemail and broadband, the latest edition of the Oxford Junior Dictionary has opted to drop terms pertaining to old …
Are bacteria faster than a computer? According a group of biological engineers they are. The scientists have done a research in which they have used the well-known bacteria …
It is a home to crawlers, virusses, search engines, gamers, spammers, chatters, twitters, bloggers, worms and spiders. If calling it alive goes too far, it's still safe to say …
Apparently, camouflaging oneself with digital patterns rather than nature-imitated patterns functions as a better camouflage within "old-nature" situations. So the digital …
Drinkpeedrinkpeedrinkpee is a project by Britta Riley and Rebecca Bray about the role our bodies play in larger ecosystems. It's an installation about the Urine to Fertilzer DIY …
For over 40 years Australian artist Stelios Arcadious Stelarc has made art with medical instruments, prosthetics, robots, virtual reality systems and biotechnology to investigate …
Crying, talking, sleeping, walking... not really, but this is what Cliff Richard's concept could look like when laboratorised. "To demonstrate a new method for fabricating …
Gadgets! You love them when you buy them, but what happens next? Over half of Brits have abandoned gadgets because they don't know how to use them properly. Seventy-one per cent …
This smart-looking image is a model of what James M. Tour at Rice University (Texas) and his research team like to call a 'nanocar'. The clustered molecules can roll around on a …
The image above shows the chair design from the Nature v2.01 project by draw me a sheep . As we struggle to find a new relation with nature, the difference between nature and …
Bird spotting is not a typical activity for us next nature explorers, yet occasionally we bump into some birds worth mentioning (remember the amazing copy-paste bird , rubber duck …
A major breakthrough in the world of genetics: Researchers have successfully reprogrammed skin cells into stem cells. Using a technique called iPS cell reprogramming (developed in …
We are anxiously waiting for the robot that makes the sushi, but at Squse , they have created the hand that can carefully place the delicacies in a box without crushing them. …
://nextnature.net I tend to think of the Philips Wake Up Light as a product of missed opportunity: Good concept, implementation too cheap and illustrative. Especially the crappy …
Justin Shull investigates the born and the made by mixing them up in mobile installations like the "Terrestrial Shrub Rover" and the "Porta Hedge" . His designs consist of several …
Some years ago scientists managed to build a rudimentary invisibility cloak, which was an impressive device but it had some important limitations, not least of which was that it …
As we are nearing the end of the year, and anticipate you might have some time to watch a film, we discus our top 10 Next Nature movies. Idiocracy (2006) is not a great film, …
Two grannies assessing the milk productivity of two goats by means of a chart: this is the story of the commercial behind this screenshot. The first granny is a data analysis …
If you haven't read the recently posted essay " Razorius Gilletus – On the Origin of a Next Species ?", you probably won't understand much of the following. Anyhow, I'd want to …
What if a scratch on your car door could heal itself, just like the human skin does? Engineers are working on a way to transfer the self-healing ability of the skin to surfaces …
Are we creating the penicillin or the asbestos of the 21st century? In the months preceding our Nano Supermarket Project , we share some speculative nanotech products with you. …
In millions of offices and homes around the world, people are hard at work planting crops, feeding cattle and tilling their land. Welcome to Farmville , the digital rural world …
Out of the cursorwoods of course! Our peculiar image of the week was created by Nathan W. Pyle . Thanks Willem H. Lucas .
Researchers are working on a language and a device that will help humans and dolphins talk with each other. Denise Herzing , a researcher and founder of the Wild Dolphin Project …
The Belgian Blue is a unique cattle breed that was developed quite accidentally in the late 1800s. An chance mutation lead the cattle to develop 'double muscling,' which occurs …
If a light switch would be hairy or snotty nobody would want to turn on the light anymore, which is exactly why designer Katrin Baumgarten created some of the most one nauseating …
Fakeness is traditionally associated with inferiority; cheap Rolexes that break in two weeks, plastic Christmas trees, leaking silicone breasts, imitation caviar... However, in a …
Another step in the fusion of the made & the born: Surgeons in Sweden have successfully transplanted a fully synthetic, tissue-engineered organ – a trachea– into a man with …
It works like this. Position yourself with a friend in front of a battery hen and flap your arms as fast as you can when the music sets in. The harder you flap the faster your …
Along with the Heck cattle and Scottish Highlanders , another reconstructed species roams the Dutch dunes . The sturdy Konik horse , also known as the Polish primitive, is the …
Earth has had a geosphere, atmosphere and biosphere for a few billion years. Only within the last several thousand years has earth gained a global noosphere, the intangible …
Imagine a world where the shapes of all objects around you would be able to change on the fly. Envision a future where nanotechnology and morphing become ubiquitous and blend in …
Over the coming years, nanotechnology will invade our everyday lives. Nanotechnology, usually defined as the control and manipulation of matter at the nanoscale, will be …
Recently Google slapped our site with a warning that "something's not right here!" It seems that the Drug Enforcement Agency has caught the Next Nature staff handing out baggies …
Human design brings us ‘natural’ experiences that could not exist without the human hand, but can be appreciated nevertheless. Perhaps we are intuitively faked to believe …
While some of us might have heard of the humorous but fictional ' spider pig ,' spidergoats are the real deal. Although you might expect to see them lounging in giant webs or …
Scientists in China have created transgenic cows that produce 'human' milk. The researchers boosted the fat content of the milk and added three types of proteins, unique to …
Ever wish you could express yourself better over Skype? Tired of being a disconnected head-in-a-box? A team at Stanford University has rigged a Mac computer screen to shake its …
Fat is what makes ice cream taste rich and creamy. It's called ice cream, after all, not ice skim milk. So how have some manufacturers managed to make reduced fat ice cream that …
In more next natural news from Hurricane Sandy, Anheuser-Busch, parent company of the American beer brand Budweiser, has been canning water for victims of the disaster. The …
For city-dwellers, the closest 'true wilderness' to be found is usually the weeds sprouting in abandoned lots. Snow-capped, postcard nature might be beautiful but is …
The standard story of the cowboy hat goes something like this: In 1865, J.B. Stetson went out west during the California gold rush. He observed that bowlers, raccoon hats, and …
Magic Meatballs are designed to playfully familiarize children with lab-grown meat.
Improving on photosynthesis has long been a dream for scientists. The so-called artificial leaf – which wouldn't necessarily look like one – would run on only solar energy and …
Life is bleak and bleached for many of the world's corals. Fatal bleaching events triggered by warming seas have become common from the Caribbean to Australia. More worrying still …
Famed for its jaguars, orchids, and horrifying parasites, the Amazon is just as famous for what it lacks: human presence. For many years, the prevailing wisdom has been that …
The number one argument for eating meat: it provides nutritious proteins that cannot be entirely supplied by vegetarian alternatives. Like it or not, humans are omnivores. Meat is …
At first sight it seems plain wrong to roast your burgers on this utterly technological machine: barbecuing is supposed to be a nostalgic low-tech activity that brings us back to …
You cannot look around your local environment without seeing something made out of plastic. Almost all the stuff we buy is packaged in plastic. Since recycling packaging materials …
While the Pacific garbage patch is often characterized as a dense, Texas-sized island of plastic, in reality it's an area of 2,736 square km scattered with tiny, floating bits of …
Neural synapses in the human brain are extraordinarily complex structures. Responsible for relaying information between neurons, chemical synapses govern the release of over 100 …
It's nothing new that humanity is getting chubbier by the day. What's surprising is that we're bringing our animals along for the ride. A meta-analysis of animal weight has …
Anthropomorphic products enter the human social space. Humans have the most complex social behavior of any organism on Earth. Anyone or anything trying to join in should be careful to do it right.
While for most of us, happy blog readers, access to electricity is taken for granted, things are quite different in developing regions of the world. In India for example, over 65% …
On the shortlist for the year's strangest book title , Jonathan Olivares' A Taxonomy of Office Chairs charts the "evolution" of chairs from the 1840s to the present day. The …
Imagine you buy a special kind of window which you can place on your wall wherever you want, enabling you to get different views, not always looking at the same tree or house of your neighbors.
Artist Bartholomäus Traubeck created a hyper-nostalgic record player that, rather than making music from vintage vinyl records, uses slices of woods to generate sound.
A new study from the marine conservation group Oceana reveals that a full one-third of seafood across the US is mislabeled. Not surprisingly, the most expensive fish is also the …
3D printers using concrete can now create complete houses from the ground-up.
The robot in the picture above chases and attacks the living rat rights besides it. The W-3, as the robot is named, is designed to make rats seriously depressed. In fact, this …
What one ugly overpass in Berlin reveals about our attitudes towards nature.
Old ironworks in Germany have become more natural than "real" nature.
Will extended pollution cause carnivorous plants to turn to a fully vegetarian diet?
Ever played "telephone" or "chinese whispers" as a kid? Now, you can pit your speech recognition skills against a computer.
An algorithm observes human players to learn how to beat Super Mario Bros.
Unpolished creativity at the Next Nature lab from the Industrial Design Department at the Eindhoven University of Technology.
Biohacker Tim Cannon inserted a chip into his arm to monitor his bodily data and transmit it to an Android device.
Paint with meat! is a product for children of 5-10 years old. It allows them to prepare a meat dish on their own and in a very creative, fun and safe way: by painting with meat!
A new kind of piezotronic transistor mesh could make for robotic skin that’s as sensitive as your own is, covered in thousands of tiny mechanical hairs.
How "celebrity endorsements" transformed the potato from the devil's tuber into a global staple.
Emotionally the avatar has a similar position as ones best friend, despite its "virtual" presence and the often longer lasting relationship with ones best friend.
How can we anticipate what happens after the technological singularity?
What to do when earth is not enough? Thousands of people, tired of their life on Earth, are ready to emigrate to Mars. Since subscriptions opened on April 22, 80,000 people have …
Google has just submitted a patent for lie-detecting throat tattoo that can also make calls.
Cheetos and other junk foods are more carefully engineered than the average bridge.
A speculative nanotech pill that lets you virtually rove your body, zapping cancer cells as you go.
Imagine the devastation when there are more Lego minifigs on Earth than humans...
How the extinction of mammoths changed the atmosphere.
Unlock our devices with our fingerprint, this technology for security represents a change in our digital life.
Conservation workers ask synthetic biologists to help them save the world's endangered creatures and habitats.
Imagine your home adapting itself to seasonal, meteorological and even astronomical conditions by changing its shape. D*Dynamic is based on the discovery of mathematician Henry …
Can a meal replacer save us money, time, and maybe even save the world?
The first – and only – mechanical gears found in nature.
The worms crawl in, the worms crawl out, the warms build pavilions made of polygonal silk panels.
From small stores to the US government, what the world thinks of bitcoin.
Neurofeedback shows promises in treating a range of mental ailments.
Map-enthusiast Valerie Pieris has created a fascinating visualization of human population centers. We all know that a huge fraction of humanity lives in Asia, but this map really …
The surprising - and predictably depressing - reasons why lobster stocks are booming.
100% pure organic coconut water would be to drink directly from the coconut. So how organic is this product really? 80% Organic? 70% Organic? Or just slightly more organic than the coconut water without the labeling?
Isaac Asimov predicts in 1964 what the world will look like today, in 2014.
As a consequence of a big water diversion project to irrigate surrounding areas the Aral Sea is drying up.
Project Loon by Google has the mission of providing Internet access to rural and remote areas, with a hot air balloon network.
LifeHand 2: a prosthetic hand that infers the ability to feel rudimentary shapes and forms by touch.
Cars increasingly rely on technology designed to make driving easier and safer. But are these improvements creating less-skilled drivers?
Electronic whiskers put sensitive catlike sensors on robots.
In glass capsules endangered rainforest flora will be able to survive regardless of what happens to their natural habitat.
Zebrafish can regrow fins. Is there a possibility we can regrow bones in the near future?
For most of history, poliomyelitis was a relatively unremarkable disease – it caused paralysis and occasionally death, but only in a tiny fraction of those infected. It was …
During the 2014 Dutch Design Week, the NANO Supermarket debuts a new line of speculative nano products.
The first digital life form is an interactive worm based on its real biology.
Healthy gut bacteria may hold the key to weight loss – but only isolated communities may preserve "natural" intestinal biomes.
Is there a possibility to clean up the oceans from plastic pollution?
The latest subspecies in the Razorius line is the Razorius Gilletus Flexball. While Gillete proclaims they reinvented shaving, others argue Gillette's new razor is everything that's wrong with America.
Researchers found a technology that allows to recover valuable substances from wastewater.
Producing an iPhone in 1991 would have cost 3,56 million of dollars.
The Spider Dress is programmed to define and protect the personal space of the wearer.
Researchers at the MIT institute recently discovered an amazing low-tech way to filter water.
Climate fiction has gone from a once-fringe genre to a standard literary device, it acts as a barometer of our own ecological anxieties.
Turning 100,000 entries from the Wikipedia into a growing nebula of human knowledge.
Italian research studio is working on EYE: a 3D bioprinted sight augmentation.
The wind turbines of the future will look like post-modern tree sculptures.
Soon, we might be getting a taste of the first lab-grown chicken meat.
In 1996 Tamagotchis were the most bought pets in the world. More than 40 million(!) were sold.
With cities covering growing area of land, we humans and our spaces build the new wilderness for animals and plants.
Studies suggest that Botox impairs the ability to process the emotional content of language, limiting the quality of emotional experiences.
A Canadian start-up that collects oxygen from the the Rocky Mountains forests and bottles it to sell.
Thync, is a new brain-altering wearable technology that promises to “shift your state of mind and conquer life” by allowing its users to change their mood whenever they need it.
A recent project, named GENESI, might make it possible for city infrastructures to communicate with us.
Architect firm Foster + Partners announced plans to build the world's first droneport in Rwanda.
Using bone conduction, this device allows to hear the sound directly in the head, keeping the ears free.
Should we make a next step in what we serve at the table? What about insects? Would you give them a try?
For the first time, researchers at the University of Linkoping , Sweden, have succeeded in establishing organic circuits within living plants. They combined electronics with the …
Bioengineers at Harvard University have created the first cyborg tissue.
Biomaterials researchers at MIT came up with a very tiny device able to monitor vital signs from deep inside the body.
If you do not want to slave away under the sun, pushing a bulky mower around, drones can do it for you.
Eco-friendly fashion is in vogue, evidenced by terms like “recycled-material” and “sustainable manufacturing” battered around as selling points for everything from sheets to …
With recent successful experiments, we may see doctors switching from the single forceps to hordes of so-called microgrippers.
With its 656 beds, this hospital offers unconventional and leading computerized assistance for all sorts of patients.
Inside the Chinese military-style rehab center for internet addicts.
A pill that makes you smarter without causing harmful side-effects? Modafinil might be this “smart-drug”.
What should I wear today? The answer to one of life’s big questions could came from an algorithm created to solve all your fashion problems.
Time Ingot is a solid piece of lead alloy, its mass can slow down time in the immediate vicinity.
The Smithsonian’s National Air and Space museum has taken the sun observation to the next level with a giant public display of images and data that show the sun in hyper-real detail.
This year's Halloween, Google asked children from the neighborhood to come by in their spooky outfits and play around the self-driving cars.
Nowadays the average teenager has more personal pink belongings than an emperor one thousand years ago
On may 21st, Next Nature Network art director Hendrik-Jan Grievink will host a workshop around the idea of Speculative Sensing: exploring the potential of senses found in nature …
While a hipster-drink bacteria are hunting space organisms, robots are catching whale snot in the open ocean.
A sky garden of cacti and artificial life forms floating a hundred thousand feet above the Earth's surface.
Hydroceramic: a composite material able to lower the temperature of an interior space by five degrees Celsius.
My New Flame uses LED technology to faithfully recreate the experience of light from the ancient past
An inspiring TED talk by computational architect Skylar Tibbits about 4D printing, where the fourth dimension is time.
How does an indigenous culture sustain, extend, and evolve nowadays? Probably, it mainly depends on the preferences of the tourism industry. Here is an example from the Mursi, one …
Plastic artist Agi Haines explores hypothetical scenarios for surgically implanted body enhancements in babies.
Breaking the silence, vegetables in a Japanese supermarket start to talk to the customers.
Agriculture today isn’t where it needs to be. Here’s how farmers are taking the next step for better agriculture tomorrow
Artists respond to biometric technology and data collecting software through subversive projects.
No matter which brand is going to rule the wireless headphones scene, it's time to get used to have a computer in our ear that we never need to take out. Until it may grow into it someday!
Fitbit just released a new motivational feature that aims to trigger their users to go out and exercise more.
Begging ghetto blasters in Utrecht are making you question poverty.
Hallstatt, a small UNESCO World Heritage city in central Austria, is the only village in the world entirely copied and rebuilt in China.
This year we are going to hand over a second Eco Coin! Do you know someone who would really deserve an Eco-Coin? Please email 'who' and 'why' to ecocoin@nextnature.net.
Open Bionics is helping children in need for bionic hands. With Iron Man, Frozen, or Star Wars-themed prosthetics, their fantasies become reality.
Google Cardboard was used by a cardiologist to train for a very risky heart surgery on a four months baby.
The lucky winner of our What’s Flying There? contest is Jiska, Dutch 10-year-old who imagined a virtual reality drone for the elderly and won an actual drone for herself.
How to monitor the effects of El Niño ? The Nature Conservancy wants to take advantage of the massive image production that can be collected using smartphones and drones. From …
Seabirds eat floating plastic debris because it smells like food, study finds.
The new recyclable, foldable and affordable bike helmet can change city bike sharing for good.
Scientists at Wageningen University, The Netherlands, grew edible crops in Martian soil.
Wanted: New jobs for humans and robots! Which designers, technicians, robot enthusiasts will help us with innovative, feasible ideas for the new jobs of the future?
Urban planners proposed a utopian superhighway for the up-and-coming organic smart city Bao’an.
Mercedes-Benz just revealed the first self-driving city coach and took it to the streets of Amsterdam for a test drive.
Scientists say they can reverse aging by reprogramming the genome.
First they banned plastic bags all over the country in July, now they released a new regulation: starting from 2020, no plastic cups, plates and cutlery can be distributed in France.
A new Google Maps app is designed to get kids exploring the Himalayas without having to actually go outside.
These birdhouses in Amsterdam share free Internet whenever the air quality improves.
Researchers are experimenting with a new technology that would be able to grow drones from chemical compounds.
Scientists in Harvard University have designed a new material inspired by organisms, such as cacti, that can effectively harvest water from thin air.
Hitech is changing sports, but what are the consequences?
The world looks quite different online, based on the country-code domains
Meet the Buddy Drone: it protects your from danger and helps you with everyday tasks, but most of all it's a friend for life!
A polymer film coating can turn contact lenses into computer screens.
The Queen Bee Drone helps solving the bee crisis of the last decade, not intruding, just bringing help and assistance.
The Vaccinator Drone will provide you with the medicine you need.
When an autonomous car has to make a decision, will self-interest or the public good predominate?
Sleeping underwater has always been your dream? Thanks to an ambitious project it will be soon reality.
We present for the real sneaker heads amongst us, six new futuristic pieces of footwear. Going from pineapple leather to self lacing 'Back to the Future' Nikes.
Australian biohacker Meow-Ludo Meow Meow implanted a chip in his thumb to make contactless payments.
Pokémon Go is shaping social relationships amongst individuals.
This robot nanny is designed to take on adult responsibilities, raising concerns regarding the consequences of using robots to raise our children.
Sunspring is a Sci-Fi short movie entrirely written by an artificial intelligence.
U.S. researchers are working on an affordable braille tablet for blind people.
Where most researchers are focusing on keeping bees alive, researchers of Harvard are developing a bee replacement; the Robobee. The Robobee is only the size of half a paperclip, with ultra thin wings flapping 120 times per second. The main goal is to build a mechanic pollinator.
What if the cause of our politic choice was in our evolution, hidden deep in our genes and digging up our tribal instincts?
Other than decompose and give nutrition to the soil, leaves can be used to store energy, becoming the raw material of batteries.
The advent of digital communications media is bringing along some health conditions.
What’s Flying There? is a coloring book that opens up new perspectives for drones applications in the human habitat.
Meet the witch who casts viruses out of computers with magic.
The first cyborg Olympics will take place in Zurich in October.
Over a four year project period, researchers will use artificial intelligence to understand the dolphin language, creating a dolphin dictionary.
One fan has become so impatient for the conclusion to "Game of Thrones", he's programmed an AI to write it for him. Move over, George R.R. Martin!
The biggest artificial sun was set up in Germany to find out how carbon neutral fuel can be produced.
Researchers have found a way to use our brainwave as a verification of our identity.
We know how it feels to catch a cold; how might it feel to catch malware?
Climate change turns rainforest leaves into junk food.
Brighter inks, without pigment: nanostructured capsules could bring about paints and electronic displays that never fade.
This year the ECO coin will run its first community experiment with our partners at DGTL festival. Come and earn your first ECO!
German company revealed fastest electric plane.
Airbus and Italdesign unveil modular urban land and air transport system.
A neural network helps computers with image recognition. It is usually tough to fool. But one group of researchers has found a way to reliably trick it.
Exhibition Fungal Futures: design with mushrooms.
Don’t worry, a handyman doesn’t have to be a bookworm. You rather work with your hands than sitting in the library. And yet, you often need to read the manuals of the broken …
This movie titled "All My Clothes" reminds us of a more straightforward example of intimate technology: the clothes we wear every day.
What if your devices had a life of their own? Guy Farber’s playful short movie "An iReal" explores this very possibility.
"Misbehaving (Ro)bots" asks whether technology could hope to replicate these small bothersome quirks that instill a feeling of intimacy.
We think of selfhood as residing in our everyday stream of consciousness. But could we possibly have a second digital self in our online behaviors? Watch episode 3 of our Intimate Technology series.
We called upon artists, filmmakers and film enthusiasts around the world to create a one-minute videos for the intimate technology series.
Scientists have found a way to bring back the lost flavor of tomatoes.
Before a natural disaster hordes of people crowd in supermarkets and fight over the last supplies. It mirrors the savannah with cliques and groups trying to get the available food, water or shelter.
Will cows still graze fields in an in vitro future? And what might we do with these animals when they naturally die?
Next Nature Network is curating the One Minutes series for September 2017.
A needle free oral delivery system might in the future dissolve the old way of vacancies injected by syringes.
Face-detecting systems in China now authorize payments, provide access to facilities, and track down criminals.
What if you could have the taste of a juicy, sizzling burger without the destructive impact of using animals for meat? That is what Impossible Foods wants to do with its new burger.
The Pyramid of Technology toolkit is a workshop-in-a-box that helps you better understand technology and catalyze innovative processes.
A Japanese Start up brings Farmville back into real life by letting players grow physical food.
A video of a robotic bee pollinating a flower (looking more like Loopin' Louie spinning off the board game and hitting a flower) recently caught our attention. What at first sight …
A smart, huggable bed partner, who also improves your sleep quality. Sounds great, right? Soon, you might be able to order one yourself: Somnox is a soft robotic pillow that gently breathes as you hold it.
Forever by your side. Elrois a South Korean firm developed an app that allows you to engage with your dead friends lovers or idols.
Developers at Dutch-based company Arenar have designed a device that not only claims to improve the quality of sleep, but also induces lucid dreams.
Researchers designed a smart fabric able to encode data readable by a magnetometer, like the one in your phone, without electronics or batteries.
The story of money, an accessible roadmap from prehistory to digital age, from cows to credit, from gold mining to bitcoin mining. This episode: gold.
Exploring methods to better connect people to the natural world, Waag Society, in collaboration with the Dutch Botanical Gardens Association, have developed an app that allows visitors to talk with plants.
A robot inspired by a sloth was developed in order to control crops growing in our fields.
The Apenheul primate park in Apeldoorn, the Netherlands, has launched a four-year experiment to study how the primates make their mating choices.
The United Arab Emirates released plans to build a city on Mars.
Los Angeles is painting its streets white to fight urban warming and expects to lower the temperature by three degrees in the next 20 years.
Augmented reality applications are a promising alternative to GPS. At least that is what Blippar’s AR City app claims to be.
In Bali, volcanic danger looms large. Scientists are trying to use drones to forestall the danger and make the invisible workings of the volcano visible.
When two people have a fight it is not really the end until it’s e-end. We finally have a chance to kick somebody out of our lives. People typically remove someone from friends or …
Scientists developed an e-skin that lets the wearer manipulate virtual objects without touching them, by using magnetic fields.
What to do about the plastic planet ? The seas are steadily filling up with plastic , and it's vital to find ways to address the problem . One way to do this is to move away from …
eSports is the huge industry that’s growing up around competitive online gaming. Let’s take a look at how this cyberpunk sporting world came to be.
As a digital detox dietitian, you know exactly how much digital technology your client needs and you give professional advice with a personal approach.
Bricklayer, a physically heavy occupation, becomes a lot more bearable with the street-knitting robot. The street knitter is a job from HUBOT.
Before fully autonomous cars take over our streets, we may experience a transition phase: Fasten your seatbelts, as Nissan introduced a so-called Brain to Vehicle (B2V) system to …
Scientists have been hard at work searching for renewable energy sources. Now, a new breakthrough: the ability to produce hydrogen fuel from seawater.
Five people suspected of illegal gold mining in Peru are in custody after indigenous community members used a system called ForestLink to alert authorities to the activity. …
Genealogy services have exploded over the past few years, and Spotify is capitalizing on the boom by providing curated playlist based on users’ DNA. Here's what you should know. …
We’ve been told since grade school that what we eat is important, but we’ve all been told to eat the same sort of healthy things. This isn’t bad, but with the up-and-coming …
Images largely shape our experience of reality. Just consider how imagery of nature continues to rise in popularity: only a society no longer grounded in their natural landscape …
Researchers are using VR as an empathy tool to help neurotypical teachers understand their students with autism. There have already been attempts to use VR to help autistic …
Don’t adjust your TV set, that’s just a new computer-generated news anchor working out the bugs. Xinhua, a Chinese state-run media company, and Sogou, a Beijing-based search …
The emerging technology of the artificial womb confronts us with a series of moral and societal questions. How to cope with that? Join us on 29 March at Eindhoven University of …
The world is developing, climate change is happening and it's time for us to do something. Now. One strategy would be to simply stop eating meat — or at least reduce the amount of …
Cube Design Museum in Kerkrade and Cooper Hewitt in New York present the comprehensive exhibition NATURE - in which internationally renowned designers, artists and inventors …
Whether you're in need of a holiday gift for your techie spouse or tech-adverse grandpa, the truth is, your loved ones deserve better than a generic gift card. Now we understand …
Within a few years, it may be possible for premature babies to grow inside an artificial womb. And when that day arrives, should men be able to give birth to children? Should we …
Travelling to work, meeting friends for a catch up or just doing some shopping are often taken for granted by people with no known disabilities. For the visually impaired, these …
Each year we celebrate ecological heroes as part of our ECO Coin Award and this year is no different. Have you seen an inspiring person who is making the world a more …
Humanity has an insatiable hunger for meat. Since 2013 we have been researching, developing and campaigning for a humane and eco-friendly way to get our protein fix. Since day one …
Imagine waking in the night, and feeling the vibrations of an earthquake on the other side of the world pulsing through your body. This is a reality for Catalan-born artist Moon …
“ Google choose the fastest route to home.” Today, drivers are better informed about routes and traffic than ever before . Using 'mapping apps', drivers can see traffic before …
James Lovelock (1919) has lived on Earth for over a century. You may find that long, but it is short for himself. He thinks big and from a long-term awareness. At the age of …
If you are a regular reader of content from Next Nature, then you know that 3D printing can be used in all sorts of technological developments, such as organ printing , food waste …
This is #3 in our cyborg mythologies series, where we explore the cyborg as a historical being intertwined within mythologism, ancient religion and sacred iconology. A way to …
Can we create a new biosphere on another planet? Documentary "Spaceship Earth" shows how - in the Arizona desert.
For multispecies feminist theorist Donna J. Haraway, “it matters what stories make worlds, what worlds make stories.” She studies the current age as the Chthulucene (chthon, …
Architect Rachel Armstrong establishes an alternative approach to sustainability. Through a close reading of computational properties of the natural world, Armstrong develops a …
FIBER Festival explores the future of a changing world through audiovisual art, daring conversations, and experimental electronic music.
Regeneration of extinct flavor families via microalgae
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
The new sci-fi musical “ Neptune Frost ,” set in a Rwandan village constructed with computer parts, tells the story of an intersex hacker and a coltan miner who lead an anarchist …
The next solar farms might be located in space, instead of on Earth. A prototype satellite by Caltech launched in January seems to be up and running, showing its capability to …
Biotechnology startup Cortical Labs successfully guided human brain cells in a petri dish through a simulated game of Pong.
We interviewed William Myers and Emma van der Leest, curators of Nature Loves Technology, our exhibition at Floriade 2022
Seven examples of how design will help us built the farm of tomorrow.
This weekend is the last change to visit the Entry 2006 exhibition in the coalwashe building, Zollverein. Over 300 exhibits from more than 20 countries are on display. Next nature …
The body suit pictured above has LEDs that illuminate according to the wearer's state of excitement. Skin signals are measured and change light emission through biometric sensing …
The pattern on the Animal Sweater suggests a new way to experience commercial imagery. The Animal sweater, designed by Karl Grandin, was first shown at The Biggest Visual Power …
Those crazy Germans are planning to build modern versions of pyramids that will function as gigantic burial sites. "The Great Pyramid can potentially be any human being's grave or …
I guess we shouldn't expect better from Axe. I'm sure it makes watching internet porn feel so much more like the real thing. One of those products that is a clear signal to RUN if …
This cell-shaped building for the institute for Nanobiomedical Technology & Membrane Biology in Chengdu, China, is an unusual croos-disciplinary collaboration between MIT …
Israelian typographer Oded Ezer looks at the world from his point of view, through letters and numbers. So why not turn the world into typography. A short interview taken from …
Somehow next nature seems to reveal itself through furniture. Earlier we've featured the treetrunk bench , the bone chair , the folding chair , sketch furniture and how to grow a …
Botanicalls is a system that allows plants to call their owner when they need more (or less) sunlight or water. It works by placing moisture and light sensors in plants and then …
What has a virtual world got to do with CO2 emissions? Yes. Electricity. Computers are getting increasingly more powerful and thus, using increasingly more power. Cleanbits (Dutch …
By putting this cockroach in control over a mobile robot, our perception of the animal is changed. Technology empowers the little creature you would normally squash under your …
Picnic Green Challenge calls upon people like you to invent a product or service that can help to save the world. Restore the planet's harmony and lets you win 500.000 Euro on the …
Scientists have written a message into the DNA of a living organism , a breakthrough they believe could lead to a new era of organic computers capable of healing themselves if …
NeuroSky (founded in 2004) innovator in "wearable" bio-sensor/signal processing systems and SEGA TOYS are developing mind-controlled computer games and next generation consumer …
Do you happen to know the Dutch Tomatoes? They look like Ferrari's and taste like shit. They are redder, rounder, larger, and maybe even healthier than the ones from our gardens. …
Espace Pur by Marc Hottinger & Lucien Iseli (MID-ECAL) is an air ionizer that uses dust as pixels and that displays patterns thanks to it, in a very slow motion way. It cleans …
You can't beat the real thing, but then again, some generations seem to prefer the other choice. Competition between cola brands goes back a long time. Over the years, the two …
This French Aids campaign is a wonderful example of biomimicmarketing (using images of old nature for propaganda or marketing purposes). They may be disturbing but the message …
IVY is an external hard disk which shows the content of the hard disk on its skin. When no data is stored on IVY, its skin will remain blank. When you purchase IVY, it appears to …
Feel unhappy? Little depressed? Headaches? Why not try a little trip to de Arizona desert? Richard Chaplin built the Interstellar Light Collector. As is often the case, tragedy …
Philips hits the shops with a product that aims to naturalize alarm clocks. The annoying buzzing machines were once invented to cultivate our day/night rhythms, formerly connected …
Phone, internet, television, photography, even books or music: today it is hard for the mind to escape from virtual worlds. A day without communication or interaction could make …
Nothing makes a person more modest about future speculations than Retro Future. Want proof? Here is a 1958 video entitled " Magic Highway USA ". No, they didn't anticipate traffic …
wired.com | video | Related posts: Robotic hand | Bionic arm Invented by Dan Didrick of Naples, Florida, the device has NO batteries, electronics, servos or actuators. Instead, …
Corpus 2.0 by Marcia Nolte is a set of seven portraits illustrating how the human body could adjust itself to the design of products, including an enlarged SMS thumb (above), an …
IKEA is going to sell furniture with Electronic Arts via The Sims 2 game. Soon, it will be possible for you game addicts, to refurbish your Sims living room into your own …
Some months ago we sent out a call for proposals asking for visions, statements & ideas on we how we can design, build and live in next nature. We received an overwhelming …
These ships were abandoned over twenty years ago. Their owners left them to die after the Chernobyl disaster due to their high levels of radiation. One of the great ironies of the …
Lots of clouds this week. The peculiar picture above shows the eruption of mount Pinatubo in 1991, which apparently resulted in a certain amount of global cooling (next to some …
This impression shows the ambitions of the city of Rotterdam for the coming decade. The city is supposed to have an image problem concerning its greenlife; as a big industrial …
The Fake for Real memory game was sold in a stylish box with a pattern resembling the internationally known and faked Louis Vuitton pattern. The LV pattern was ironically mimicked …
Rising supermarket prices are persuading hundreds of families to turn their back gardens into mini-ranches stocked with miniature cattle. For between £200 and £2,000, people can …
The Fake for Real Memory Game – consisting of 60 cards that playfully visualize the classical theme of fake and real in our society – has temporarily been taken offline due to …
Fifteen policemen rushed to the scene, after a couple reported to have bumped into a "corpse" while out walking their dog in a mountain forest in Izu, central Japan. The officers …
Viganella is a small town in the Italian Apls. It is located in a valley between very steep mountains. The mountains are so steep that from November the village ends up in the …
The people at Preem.se – the Swedish organization responsible for this advertisement – must think this is the way to promote environmental protection with a younger generation of …
The RepRap is a selfreproducing 3D printer. The 3D printer 'prints' his own components by melting tiny plastic particles together. Imagine what would happen if this 3D printer …
If you've ever wanted to know just exactly how much DNA you share with your ridiculously tall brother or doppelganger best friend, you'll soon be able to find out. 23andMe , a …
Now why is that girl so excitingly staring at a few blurry blobs on a flat screen? Is it because these blobs are connected to her breath... What? Yes that is right, you are …
Designer Laura Boffi envisions a future in which human instincts will leap behind on technological progress. For example, once the 'disease called mortality' is cured with …
Forget about palmistry! MRI scans for candidates in top jobs such as bank directors could soon become part of the job-application package, says Erasmus University researcher Prof …
Remember the bacteria that eat waste and shit petrol ? How about some microbes that eat plant waste and turn it in to sugar? Now you might say you have no need for sugar as you …
Perhaps in the long run, historians will consider this as the official end of modernity as we knew it: The comeback of the wonky cucumber, abnormally bent banana, and comedy …
Engraved Hairy Crab: fake or real? ??? (Dazha crab), or more widely known as Shanghai Hairy Crab, is in season right now. This typical Shanghai delicacy is particularly sought …
If the six hour crash course on synthetic genomics is a bit too much for you, there is always a more snappy TED lecture in which Craig Venter ponders on whether we can create new …
Next Monday when your colleagues ask you what you have been doing for the weekend, you might answer you something default like you went out with friends, danced, biked to the …
Exmovere Holdings , a biomedical engineering company, is focused on government and consumer applications for healthcare, security and mobility. This company developed Exmovere …
The Eyeborg Project is the work of Rob Spence, a 36 year old filmmaker residing in Toronto, Canada and Kosta Grammatis – an unemployed engineer from San Francisco, California. …
Daring talk by agriculture expert Louise Fresco , who has the guts to break the organic trance of the fashionably-natural-farmers-market people at TED . During her talk she is …
Parks are not nature. Parks are culture: man-made simulations of nature, carefully constructed to provide walkers, runners and mountain bikers with a recreational, yet confined – …
Will we in the future still buy several needs according food in shops, or will we grow M&M’s ourselves? There is a lot happening on in the field of food technology , think for …
The big lobby to endeavor for a climate neutral lifestyle must have reached its peak. It is common knowledge that recycling electronic and battery operated utensils is better for …
Graphic designer Roel Boonen takes the Apple cult to the extreme with this iReligion triptych. His piece is illustrative on how central corporations and digital technology have …
Meet KOBIAN, the humanoid robot that is not only able to walk about and interact with humans, but uses its entire body in addition to its facial expressions to display a full …
This mashup video project integrates various video clips that ask: What is nanotechnology? Via Posthumanblues , via Futureblogger . See also: Small Talks , Bacteria Bots , …
As technology evolves, people are more and more depending on it to function properly. But the nature of technology is that it needs networks, sources, software, batteries and …
English Robins are forced to sing their song during the night. Not because they have figured out that music just sounds better in the dark, but because they can't compete with the …
Following anorexia nervosa (under eating) and bulimia nervosa (overeating and compensating), orthorexia nervosa (obsessively healthy eating) is the latest eating disorder in the …
Looking at a banana from a design perspective, one immediately notices the fruit is highly ergonomic and sophisticated: Bananas fit perfectly in the human hand, they come with a …
The Discovery series 'Ways to save the planet' the episode 'Wrapping Greenland ' shows how Dr. Jason Box uses reflective blankets to cover glaciers in Greenland. Due to global …
Behold "the world's first production model 3D bio-printer." A machine capable of arranging human cells and artificial scaffolds into complex three-dimensional structures, which …
We recreate the landscape according to our image of nature and to match our needs and expectations. This also applies for the urban landscape. In the NY Times of last week, Thomas …
Though I did not eat as many crayons as PiPi growing up, I’m sure we all remember the first day we tasted wax. How can something *look* so tasty, yet be totally bland. But I …
Climate change is often thought to have its winners and losers, with Canada, Nordic countries and Russia being portrayed as among the lucky few chilly nations where moderate …
Man is a flexible species. We tend to adapt quite rapidly to new environments. But how fast can these adaptations turn to new evolutionary traits? For instance: to what extent is …
Coughing into your cell phone could soon save you a trip to the doctor's office. Thanks to software currently being developed by Star Analytical Services , people may soon be able …
The food printer seems to be one of those lustrous concepts that continues to pop-up in the fantasy of techno-connoisseurs. Some years ago James King already proposed a printed …
Scientists have developed a mosquito that spreads vaccine instead of disease. The researchers, led by molecular geneticist Shigeto Yoshida of Jichi Medical University in Tochigi …
Alright the title "Making Perfect Life" ' may sound a bit 20th-century-modernistic-techno-optimistic-naive, but for the rest we are confident this conference is going to be pretty …
Bacteria are traditionally perceived as infectious and unhealthy, but that is about to change. This week designer Jan van der Asdonk graduated from the Next Nature Lab at the TU/e …
Buckle up for the state of the art in the fusion of the made & the born. Anthony Atala of the Wake Forest Institute for Regenerative Medicine presented footage of his …
Could this 2.0-bird be suffering from Infobesity ? Then it must be the result of excessive infocalorie consumption. Following people and news-sources on microblogservices like …
The Intimacy dress takes our notion personal space to a next level: the closer someone approaches, the more transparent the dress becomes. As such, the garment becomes a sort of …
Last week I opened a bag of potato crisps that read: "We know the origins of all our ingredients" . As some crisps had already disappeared down my throat, this made me suddenly …
After making the successful and popular movie Avatar (2009), James Cameron started the Avatar Home Tree Initiative . This initiative consists of building "Avatar" forests on 17 …
The suited guy in the video is an employee from the office of materials that goes into the wilderness to test if it would have been possible to create a fully functioning …
In this first review of the works of Manko, we'll discuss the complex sorts of plagiarism in Augmented Reality art that are typical for our contemporary art scene. This introduces …
From our reliable source – who wishes to remain anonymous – we know that this is exactly the same rooster that was used in the Philips WakeUp Light test , but only one year later. …
Mud tub is an experimental tangible interface that allows people to control a computer while playing in the mud. By sloshing, squishing, pulling, punching, etc, in a tub of mud …
We live an increasing amount of our lives online, but what happens to our digital identity after we are gone? Until now our blogs, photos and social network accounts have lived …
As we are calling for debate-provoking nanotech products that might hit the shelves of the Supermarket in the next ten years , some products much crazier than the ones we could …
Nanotechnology has been hailed for its benefits because of the potential ability to create drugs that could cure cancer and radiation poisoning, make miniature pollutant filters …
Samsung has released the results of a consumer study that indicated nearly a third of Denver–area residents would sooner give up sex for a year that go without a cell phone for …
At Tokyo's Shinagawa Station visitors can now select beverages from a 47-inch touch panel. An embedded camera will recognize your gender and age, allowing the machine to …
An earlier post on Next Nature learned that The Good People behind Webwill provide us with a service to extend our lives on social networks after our physical death. But what if …
Some matches remain interesting, even though they're predictable. Take the continuous battle between technology and football. Every time the stakes get high, such as at the World …
"Until now, the major obstacle that has prevented people from thinking critically about stray shopping carts has been that we have not had any formalized language to differentiate …
Brian Eno - artist, composer, inventor, thinker - spoke to Kevin Kelly about the meaning of Africa for music and technology. "Africa is everything that something like classical …
As neuroscience progresses, we gain access to previously inaccessible and unexplored areas of the human mind. Consequentially the intricate processes in our brain are cultivated …
By hooking up a commercially available EEG headset to a Nokia N900 smartphone, Jakob Eg Larsen and colleagues at the Technical University of Denmark in Kongens Lyngby have created …
http://www.youtube.com/ watch?v=BGPGknpq3e0 Narrated by the incomparable David Attenborough, this footage goes to show that urban birds really are smarter . The cross-walking …
Thinking about Next Nature can sometimes result in a feeling of vertigo. Normal standards are eroded and slowly replaced by next natural ones. A bewildering example can be found …
Want to live a greener life? Eat less meat. Recently the UN appealed for a radical shift in diet , to improve individual health and ease conditions affecting the global …
A while ago I wrote a post about birds which tried to adapt to the city by singing louder and in different tones than before. Now it seems the birds have taken this adaptation to …
Remember the Information Decoration essay which argued our so-called information society barely employs our human bandwidth, as most of the data in our lives is presented in …
The children looked startled. 'Leaving?', Askr asked. 'But it's not time yet!', Embla said. Manko had no clue of what was going on. Not yet time for what? The red ball turned …
Zero: 'Where to begin? We've had many discussions in our Lab about the future of the children. The plan was simple: to raise the kids to the physical age to be 'frozen' in. Then, …
In the film Mastering Bambi, artists Persijn Broersen and Margit Lukacs have stripped the landscape of its cuddly, anthropomorphic characters. Over the course of the film, the …
Beautiful Google Maps shots of housing projects in southwest Florida. Probably designed to look and feel more natural than your average straight street neighborhood, they remind …
Yale researchers and advertising executives have created the first ad campaign aimed at animals. The targets in question are a group of captive capuchin monkeys with a taste for …
It's no secret that Mickey Mouse has evolved in response to consumer pressures. Once a violent river-rat, he became the boy scout of rodents with good looks to match. Steven Jay …
Are we creating the penicillin or the asbestos of the 21st century? Prior to the arrival of the Nano Supermarket , we share some speculative nanotech products with you. Here’s the …
Quoted in a recent interview about his work, Landscapes without Memory , artist Joan Fontcuberta asked, “Could a natural nature exist? The answer is no, or at least, not anymore: …
A little girl gets angry at her father, and uses her index finger and thumb to make a pinching motion . No, she's not trying to hurt him. She's using iPad sign language to say, "I …
Say hello to teacher Engkey ! The city of Daegu — South Korea, introduced 29 robot teachers in 19 elementary schools as part of a large scale project to robotize teaching. The …
Tweenbots are small robots that depend on the kindness of strangers. They are only able to move straight forward and do this constantly. Once they get stuck in a hole or at a …
Christopher Quinn and Tommy Walker's documentary ' God Grew Tired of Us ' tells the odyssey of four boys from Sudan who embark on a journey to America after years of wandering …
More real than you think. Peculiar image of the week. Via . Thanks Ton .
Did you know that phones were once used for calling up our (human) friends? Researching the beginning of it all, we came accross demo video's on the cloud called "internet" where …
On Youtube, there's a whole sub-genera of safari videos that show, in gruesome detail, what exactly it means to live and die in Old Nature. The above film is a particularly …
Transporting and displaying cold food is an incredibly wasteful and inefficient process. Current display refrigerators, like those that display meats or cheeses in supermarkets, …
A study, in Language and Cognition has shown that time does not exist as a separate concept for the Brazilian Amondawa – an Amazon tribe first contacted by the outside world in …
If you've noticed candy-colored pigeons flapping through Copenhagen lately, don't blame a freak chemical spill. Artist Julien Charriere and photographer Julius von Bismark have …
Farmers have long made frugal use of their table scraps, feeding their leftovers to hogs, dogs and now, cows. In a bizarre sign of our cash-strapped and climate-changing …
Scientists have developed a biomimetic robot that will be able to swim forever, since its artificial muscles are powered by water. And since Robojelly lives underwater, it will …
Christian Schwägerl , freelance journalist and biologist, author of the book The Anthropocene: The Human Era and How It Shapes Our Planet , introduces us into the Anthropocene , a …
Congrats to Sean Serafini, the winner of our April Next Nature Spotter contest. While we received many images of fake nature , Sean's entry delves deeper into more diverse next …
Same article , different example: Water Powered JetPack by Jetlev . (Thanks: Marlies Peeters)
Rather than growing whole steaks in bio-reactors, Knitted Meat assumes that it is more feasible to create thin threads of protein. Supermarkets sell balls of meat fiber seasoned …
As the planet’s population speeds towards 9 billion, it’s becomes impossible to continue consuming meat like we do today. Will we all be eating rice and beans? Grasshoppers …
Many people still find in vitro meat too alien and artificial to put it in their mouths. With the Rustic In Vitro incubator, this outdated perception is about to change. Similar …
During the coming weeks, we present a selection of our favorite pages from the Next Nature book . This week a page that is an homage to Marshall McLuhan, who is one of the most …
Most corn has been selectively bred over the centuries to be a single color: yellow, white or blue. Glass gem corn, a varietal grown by Greg Schoen , harkens back to the days when …
In a twist on the classic " microbes that turn shit into petrol ", researchers at MIT have developed a bacterium that turns carbon dioxide into a direct substitute for gasoline. …
Children can be effortlessly entertained for hours thanks to tablet and smartphone games, but these technologies also provide a solution for the lazy pet owner. More videos of …
MoMA in New York has a new exhibit exploring what can be done with American's only seemingly inexhaustible resource: foreclosed homes and sparsely inhabited suburbs. Nature-City …
Should made-to-order babies become a reality in the near future, one piece of the design puzzle has been solved now Pantone has release their SkinTone system. Indexing 110 skin …
Besides children and pets , it turns out that pigs are also attracted to interactive interfaces. Pig Chase is a computer game in which pigs and people can play together. The aim …
In dry areas like the desert, on mountain tops or on the moon it’s impossible to grow anything. Or is it? A rain in the desert sparks extreme plant growth from the moment the …
For doom-mongers delight, the Berlin-based design studio Bold Futures made a handy interactive graph of the fatal disasters that might snuff us.
Imagine how much easier the job of window cleaners would be if they could simply scale walls like Spider-Man instead of using elevators, ladders and other gear. Ever since the …
Now here is a product that should soon find its way into the NANO Supermarket soon. At least, if supermarkets are willing to put it on their shelves, as they currently make huge …
Privacy is a right. A right given to people by telecommunications companies and social networking websites. It can be described by multiple-choice lists of settings. And it seems …
For almost three years, we worked on a sneaker company that we knew would go bankrupt on the day it was founded. This is our coming out...
Is your friend impatiently tapping on her phone, or is she just charging the battery? Researchers at the Berkeley Lab have produced the first virus-powered generator that runs off …
Closed to commercial shipping and fishing, offshore wind farms aren't put to much use besides generating clean energy. Ecofys , a Dutch sustainable consulting company, hopes to …
The high temperatures of urban environments causes trees to grow faster in the city than in rural areas. Researchers at Columbia's Earth Institute have discovered this by planting …
Loosely regulated and largely untested in clinical trials, herbal medicines nonetheless do big business based on their image of being wholesome, natural, and backed by millennia …
Often cockroaches aren’t people's best friends, but maybe in a few years you will be relieved when you see a cockroach. Researchers of the North Carolina State University …
DogTV , a new TV channel available in the US, offers 24/7 programming for the modern dog. There's busy streets, computer-animated moths and frolicking, cross-breed hounds. The …
Printable pizza. The next big food innovation after sliced bread.
Designer Robbie Tilton's keyboard replaces the impersonal metal of a keyboard with lush imitation moss and wooden keys. Though it's a good example of fake nature , Tilton's …
Military action accidentally restores a lost ecosystem.
Taking a cue from the human brain, a new microchip can rewire itself after damage.
Artificial lighting at night makes us fat, depressed and sick. What are the alternatives?
Should digital technology imitate that which exists, or could it also surpass it?
The embedded "share" button in the new Playstation assumes that sharing is at the center of our existence.
While Next Nature is hard at work normalizing the idea of eating lab-grown meat , a group of British design students are working to bring insect-eating into the mainstream. Though …
Surgery for a cute, cheerful duckface – permanently.
Two master's students have created a speculative device to simulate the sensations of eating.
Behold the first pictures of our Bistro In Vitro ice bar in the Future Food House.
Ultimately existence (or not) for gated communities comes down to the existential choice: should we be afraid of the future?
In the warming Arctic, an area the size of the US is now covered in vegetation.
Solving the world's population crisis by replacing human infants with aquatic creatures.
We thank all our supporters for making the In Vitro Cookbook possible.
Baudrillard intersects with social media in the world of fake online girlfriends.
Is a deep-fried iPad as unhealthy as a McDonald's meal?
A strange set of coincidences turn an invasive species into a hero
Chef Bun Lai of Miya's Sushi in New Haven, Connecticut, has a cheeky solution to invasive species: he eats them. His menu regularly features lionfish and Asian shore crabs, …
Two lights that behave like pets, acting and reacting like autonomous creatures.
Primitive man lived in caves. He used the surface of these caves as a canvas (*) to make representations of the things that surrounded him: animals and hunting, stories of magic …
Beautiful Mutation series from Belgian designer Maarten De Ceulaer show how herpes would dramatically enhance the look of your Yves Klein blue sofa. Indeed the velvety series …
A new material can stop toxic off-gassing from plastics, but the 'new car smell' is so valuable the car industry might not change.
Humanity has three options when it comes to our evolution. Dr. Harvey Fineberg makes a case for "neo-evolution".
Five years ago we envisioned Organic Coke as the fictional summit of Greenwashing. Now it is 2013. Guess what?
Interview with our own Koert van Mensvoort in the IKON Television Documentary 'Paradise Reset' on the future of human nature.
Cockroaches will inherit the world after humans are gone? Maybe not. Seeing plastic as the new moss, or algae, photographer Jeanny Kaethoven makes this beautiful pictures of …
The self-repairing sole is a dynamic solution to an everyday problem.
A new website changes the text's font size depending on your distance from the computer.
Italian Designer discovers new material. A ideal throne for a vegan king.
The Sniffer – aka Google Nose – visualizes odors using a smell sensor, which is as good as a dog’s nose, and a glass in front of your eyes.
Space Farming: NASA plans to grow a vegetable garden 230 miles above the Earth.
When you look into the anamorphic abyss, the anamorphic abyss also looks into you.
Restoring the sense of touch with an artificial hand, using a brain interface.
In a recent feel-good article, WIRED wrote about a special group of homeless friends in Florida who, equipped with laptops, phones and free WiFi, manage to make ends meet making …
With advances in genomics, imaging and other technology,scientists have to face the age of big data.
New wealth and old laws mean that China is awash in forged artwork.
Looking back on the first recorded attack on a human cyborg.
From the handshake to the sanitary, gender-neutral fist bump.
A bracelet able to transfer a touch between two people.
A revolutionary new smartphone for the blind uses a completely tactile interface.
Tired your ugly duds? Sick of surveillance drones? Does Adam Harvey have the clothing for you!
Break out the ketchup: Mark Post has grown the world's first entirely artificial burger from cultured beef cells.
3D printing cancer could be the future of treating cancer.
For every smartphone user to recognize, is that merely the lighting of your screen, a vibration or ring distracts you from almost every activity. Even when you are spending time …
Chemistry teacher, James Kennedy, shows us that Mother Nature's products are far sneakier and complex than the lab's.
A macaque stole a tourist's iPhone and fiddled around with it like a human would.
Nextnatural stones formed from layers of paint in old car factories.
Scientists designed a way to improve the efficiency of plants light harvesting during the photosynthesis, using nanotechnology.
Imagine you could drive your car using only your thoughts. It is now possible!
These unbelievably rich and dazzling graphics were made to avoid enemy attack.
The World View Experience offers an expensive journey to the edge of space.
First 3D-printed skull has been implanted on a 22 years old dutch women.
Asian architects of AT Design Office want to build an incredible floating underwater metropolis that is also self-sufficient.
In Japan, fake food industry represents a century of old crafting tradition and a multi billion business.
Last month graffiti artist Katsu presented his graffiti drone called the ‘’spray copter’’.
The Google self-driving car has driven 700.000 miles by itself, and now it can drive through busy city streets.
In this talk at TEDxGhent, our own Dr. Van Mensvoort shows how technology becomes nature in seven steps and what engineers, inventors, designers and entrepreneurs can learn from that.
A company is working on culturing celebrity stem cells for cannibal cuisine.
Invisible meat with a pure, delicate flavor. Honest from the Lab.
Modern technologies give deaf people the ability to hear again, not only regular sounds but also the invisible Wi-Fi signals.
Tinder users beware: somewhere out there a mechanical finger is surfing the popular dating smartphone app. This could be your next match.
The In Vitro Meat Cookbook won the Design Research Award.
There isn't an App for everything, and we need a sticker that reminds us so.
If the moon were only one pixel: a scale model of the solar system that shows how big our milky way actually is.
Like the exorbitant feathers of the peacock, which only function is to aesthetically stand out amid its competitors, this new species of Razorius Gilletus only differs from its predecessor aesthetically.
The '50s robot band, Le Trio Fantastique, is exemplary of human distant longing for technology that integrates with our body and senses, to the point of taking our place!
US-scientists extended the DNA alphabet with two new created 'foreign' building-blocks.
Our peculiar image of the week makes us shivers with Anthropomorphobia.
A new way to project yourself against sharks while enjoying your favorite watersport!
Smart contact lens project to monitor glucose.
A team of scientists created a semi-synthetic organism with an expanded genetic alphabet.
Streetlights affect local ecologies for a longer duration, and at a higher level in the food web, than previously thought.
The BionicKangaroo technologically reproducesthe unique way a kangaroo moves.
Breathtaking satellite images that will change how you see the World.
Researchers proved it is possible to provide the Moon with the wireless connectivity we have on Earth.
Thanks to 3D Babies and a mere $600,- you can now experience that excitement of holding your baby in your hands before he or she is born.
Heinz and Ford team up to use tomato skins in car parts.
Urban Skyfarm is a giant tree-shaped farm system for environmental improvement in food production and distribution.
Less than one millennium ago the Earth at night was all black. Today it is all glowing and blossoming.
Wearable multifunctional antenna made of silver nano wires to monitor recovering people.
UnderSkin is a device that would be implanted beneath the skin on your hand and charge off your body’s energy.
A lightweight and mobile structural fabric based on ancient traditions of weaving fibers.
A new technology aims to provide doctors with a true hologram of organs.
Most VR concepts and products are coming from big tech companies. With their ad-driven business models they are likely to fill your Glass, Hololens or Oculus with ads at some …
Remember these? If you are a digital native there is a chance you never noticed one of them.
Scientists in Russia have taken a next step in the development of artificial intelligence by creating a "brain" that is able to educate itself.
Parallel to the democratization of computers some decades ago, biotech is rapidly becoming more accessible to creative people outside of closed institutions.
Inspired by the award winning In Vitro Meat Cookbook , Next Nature Network and Submarine Channel present Bistro In Vitro : an online design fiction documentary about the future …
Cars - autonomous, self driving, uncontrollable - are bound to become the animals of the future.
The Federal Aviation Administration (FAA) picked six test sites throughout the US to experiment with drone-based cloud seeding.
Francesca Barchiesi's glove concept allows the user to translate hand gestures into images and information.
In the Sanctuary of Caravaggio, Italy, devotees can make offerings just by credit cards.
Designer and artist Alexandra Daisy Ginsberg explains how synthetic biology inspires her for designing the cars of the future.
Agbogbloshie is a former wetland that is turned into a slum and now it is full of toxic electronic waste.
Kirsten Zirngibl's illustrations depict imaginary landscapes that are formed by microbots.
Eyes of the Animal is an interactive project that invites the public to an uncommon virtual reality setting conceived especially for experiences in actual forests, giving the opportunity to see the world as an insect would.
Ikea’s research laboratory was inspired by our Magic Meatballs to re-design their famous meatballs.
Scientists are working on an ingenious approach to carbon capture that will enhance the way plants isolate carbon dioxide from other emissions in order to contain it.
The amount of fast food children eat may be linked to how well they do in school, a study suggests.
It was announced this week that genetic modification allowed scientists to produce cattle resistant to tuberculosis.
French student at the Design Academy Eindhoven collected hair from African American hairdressers to create jackets and hats.
It might be possible to grow a new heart in labs using spider silk.
An innovative solution to a better way for transportation: a high-speed elevated Personal Rapid Transportation system.
There are about 3.04 trillion trees on Earth. That is 422 trees per human being.
Technology breaks as an inspiration for names. Among the most popular names of 2015 we can find Instagram filters.
Think you've had enough sun? Ask your bikini!
Books allow you to fully explore a topic and immerse yourself in a deeper way than most media today.
Robot Cheetah has grown up! Scientists at MIT's Biometrics Robotics Lab have now trained their robo-feline Cheetah to detect obstacles and jump over hurdles as it runs, making it …
In the quest for competitive advantage, companies adopt wearable biometric technologies to monitor employees and improve business results.
The company MyWebwill helped you to manage your digital afterlife. Unfortunately for its subscribers the company itself has now deceased.
Researchers at Nasa's Center for Climate Simulation (NCCS) in Maryland can deploy a supercomputer called the "Discover".
After it sold out, the Next Nature book has been reprinted with a brand new cover.
We officially launched the Next Nature Movement in The Netherlands. To seal the beginning of the Next Nature Movement, director Koert van Mensvoort donated the first symbolic ECO coin.
A single tree that can produce 40 different stone fruits, or fruit with pits, including peaches, apricots, almonds, plums, cherries and nectarines.
Amazon introduced a new gadget, named Dash Button, that will help you order groceries automatically.
A new laser surgery can permanently turn eyes from brown to blue.
The speculative 'Plastivore' bird thrives on a diet of fungi and plastics.
Waterlicht shows how the Netherlands would look without waterworks — a virtual flood.
Sarah Parcak is a pioneering "satellite archaeologist" from University of Alabama, a sort of Indiana Jones with 21st century tech. She has been awarded the 2016 TED Prize for her …
English artist Imogen Heap, with an army of artists, musicians, scientists and technologists, developed the Mi.Mu gloves.
A few days ago, these images of iconic buildings in Beijing as they look with and without intense smog have been posted on Weibo, one of China’s most popular social media …
The glitch meant many woke an hour earlier than usual, leaving not just phone customers but whole households unhappy about rising early.
A group of architects looked at natural forests to design the bamboo skyscraper.
According to researchers we could go a step further and use stem cells derived from your skin cells.
BeoSound Moment is an intelligence sound system that predicts the music the user is in the mood for.
Cyborg cockroaches might be used for search-and-rescue operations in the future.
Nausea is a common feeling while playing video games. A solution would be to add a virtual nose to VR experiences.
Using immersive virtual reality and aromatics to make the brain believe we are enjoying a delicious dish.
While you were on holiday we moved both virtually and physically. We are pleased to reveal our newly designed nextnature.net . We hope the updated design makes our website more …
A remote-controlled LED chip can make a mouse walk in circles.
Scientists were inspired by nature to developed a method to shape-shift 4D-printed structures that could one day help heal wounds and be used in robotic surgical tools.
Around 100 Polish teenagers aged between 12 and 18 agreed to withstand 72 hours totally offline: no phone, no computer, no TV. What were the results?
The Microsoft HoloLens is a holographic computer that enables you to interact with high-definition holograms through augmented reality.
It is the era of smart toys, but they certainly raise difficult questions for parents.
Mark Post is planning to bring lab-grown meat on the market shelves within five years at a reasonable price.
BlackBerry has just confirmed that it will no longer create its own phones, marking the end of an era for the once dominant leader of the smartphone market.
This video by Nature explains the complexity of networks on our planet.
The coywolf: an animal that has the DNA of the wolves, coyotes and dogs.
MIT researchers have developed a system of traffic control that will make traffic lights obsolete.
Google launched the Mzansi Experience, a virtual tour to South Africa through Street View.
This father in China hired some professional gamers to find his son on online games and kill his avatar.
This year, on April 6th, a baby was born with three genetic parents: two mothers and one father.
Tracking your workout can help improve the safety and optimize routes for cyclists and pedestrians in your town.
The Norwegian Public Roads Administration proposed an underwater tunnel hanging from floating pontoons from the southern city of Kristiansand to Trondheim in the north.
Norman Foster's project for a Droneport that will give a valid, affordable alternative to reach and bring help to remote areas.
The University of West England is developing living bricks, turning your walls into a digesting organism.
Sweden is paying people to fix their belongings instead of throwing them away.
Featuring different cities at night, the Next Nature Glowing Planet T-shirt highlights the enchanting beauty of our glimmering world.
Ground Level Traffic Lights For Smartphone Zombies
A bright green is the color of 2017, a perfect choice if we take into account some of the positive developments in renewables reached in 2016.
ElectRoad developed a unique technology that powers the vehicle wirelessly from the road while driving.
Facebook boss Mark Zuckerberg at the Mobile World Congress, in Barcelona.
If you happen to be at San Francisco International Airport on the hectic Holiday time, LiLou, the airport's pig can help you alleviate the stress.
The first self-sufficient luminous bike lane opened last week in Poland.
Exploring the surface of Mars at least 15 years before a human being in flesh and blood will be able to, this is the new ambitious idea of the people at NASA.
Grown in a laboratory in Wageningen and it is vegetarian too.
There's a factory in China that produces mosquitos and their plan is to defeat the Zika virus.
Cinemas for Millennials will include special sections where texting is allowed.
Exploring ECO coin opportunities at Lowlands Festival. One coin for every plastic cup! A perfect local community to prototype the concept.
Our online reputation is becoming a valuable currency that is hard to earn and easy to lose.
Researchers at MIT have created a system that is able to simulate sounds that are so perfect that they can even fool human listeners.
Why are children still learning to read from a book? Therefore Amazon is reinventing the children’s book in the form of an educational reading app, called Rapids.
Cartographer Andy Woodruff designed maps that allow us to know what actually is over the horizon.
The first time you switch on your self-driving car, punch in your coordinates and cruise off to the soulless thrum of an electric motor you’ve got to wonder: does this thing know what it’s doing?
After calling, texting, chatting, video chatting, teledildonics (interactive and touch emulating sex toys) and sync-watching TV series while miles apart, you can kiss your beloved one over the Internet from wherever you are with Kissenger.
Today, we all have superpowers. It may not seem like it because we are attached to our physical devices to use our powers, but with a Neural Lace that may soon change.
An experiment tries to prevent crime by identifying aggressive behavior with new surveillance technology before actual violence is used.
Researchers at University of Washington have introduced a new wireless communication method that allows small wearable devices to ‘talk’ to everyday devices.
Moving tattoos from purely aesthetic crave to a healing method thanks to nanotechnology.
Coop Italia has opened a flagship store in Milan to present their vision of what grocery shopping might hold for us in 2050.
German aerial-photography group Cooper Copter is exploring “vandalism 2.0” with drones that throw paint bombs.
Self-constructing foundation thanks to genetically modified microbes.
As emerging biotechnologies are blurring the lines between synthetic food and natural food, who will regulate cellular agriculture?
The elderly may toss their walkers for this robotic suit.
The first uterus transplant in the United States raises the question: could uterus transplants allow men to get pregnant too?
There is a new breakthrough coming from the operating room: an app, called MDLinking, that connects 8.5 million doctors world wide.
United Nations aims at turning a playful technology into a serious medium.
Our cities are made out of steel and concrete. What if we replace them with wood and bone?
Severely paralyzed woman controls a tablet with her brain.
A robot monk has been created in China, mixing spirituality with artificial intelligence.
Danish design studio Kilo created an air pollution mask suitable for kids aged six and up.
Animal Meditation uses meditation guiding sounds to to enable user to feel as if he is an animal.
Bacteria use electronic messaging system to recruit new workers.
Barbie has been turned into a hologram version of herself and will now be your kids assistend.
Emoji translator wanted! London firm is looking for an emoji translator, take the test to find out if you're good enough.
Danish company develops device to stimulate creativity.
The Brand Killer augmented reality headset boomerangs ad blocking into the physical realm.
What if buildings could become trees? That vision is what Italian architect Stefano Boeri is aiming at with his Vertical Foresting.
Rising temperatures have boosted the growth rates of seasonal mosses on Antarctica, turning the continent green.
Turning cows into walking vending machines for milk.
Cigarette butts are littered everywhere. But now, two Dutch designers have come up with a unique solution to the problem: the Crowbar.
A Biomedical solutions company is developing a system for insects to wear, allowing engineers to steer it remotely.
Scientists develop engineered cells to be implanted in patients with diabetes to regulate blood sugar levels, controlled with a smartphone app.
Researchers at Virginia Tech are studying the risk of injury from a drone collision by hitting a crash test dummy in the head.
The nominations for the ECO coin Award 2017 are now officially open. Let us know who you think deserves to earn the award.
Uber built a fake city called Almono to train self-driving cars. This town is full of fake houses, mannequins and chaotic intersections.
Air New Zealand is equipping its flight attendants with AR headsets to explore in-flight optimization, giving its passengers a glimpse of what the future air travel service might look like.
What the Internet would look like if all data were ephemeral?
Gene therapy can cure up to 200 different diseases and the list is growing.
This week our virtual reality experience landed at the inaugural VR program of SXSW festival.
Startup Helix launched an online hub where you can digitally explore your genetic code by downloading different apps on your computer or smartphone.
The home healthcare professional is one of the 16 positions from HUBOT, the job agency for people and robots.
As air traffic security you make sure that birds stay away from the airport using your eagle drone. With an accessory console, you fly the quadcopter from the sideline to scare …
A start-up company build a wind turbine inspired by the hummingbird.
The Hyperloop will turn the world into a global village.
Breakroom is a VR app that lets you fill your daily working tasks in a simulated nature surrounding, enhancing productivity and mental balance.
Tokyo restaurant offers sustainable new dish - ramen noodles topped with crunchy insects and people love it
A study reveals that about 40% of "worker" ants spend most of their days doing nothing, but those lazy ants make themselves useful in unexpected ways.
The Next Nature Academy offers the philosophy, the tools and the methods that will shift the way you think about nature and technology.
NNN is looking for a Managing Director to join our office in Amsterdam.
A recent study examining the purity of 17 commercial sea salt brands from eight different countries found microplastics in all 17 samples.
The image of polluted water popsicles surely tastes better than the real thing, we hope its message goes a long way as well.
The Dutch province Gelderland-South uses two educational robots to increase kids' knowledge on such a technology.
A team of scientists developed a peculiar strategy to counter the Arctic ice melting.
Replika is your friend for life. He is 100% AI chatbot that you “raise” by chatting with it.
Birds are fascinating creatures, but for farmers, airport staff, and waste management specialists, they can prove to be a profound nuisance. How to deal with a flock of birds …
The first robotic officer will soon report for duty in Dubai.
The Brazilian model Paola Antonini uses her Instagram to show off her prosthetic limb.
The Smell of Data documentary will make its online debut on nextnature.net.
The story of money: an accessible roadmap from prehistory to digital age, from cows to credit, from gold mining to bitcoin mining. This episode: paper.
Looking for a summer book? Wherever your vacation takes you, our drones coloring book What’s Flying There? should be on your holiday packing list!
The EyeQue personal vision tracker is a smartphone app that allows you to test your eyes from the comfort of your couch.
Toilet paper for smartphones now on offer at Japanese airport.
Introducing world's first ink completely made from air pollution.
A machine lets drinkers instantly turn their empty beer bottles into sand.
How do trees feel? A team of scientists have developed a network of twittering trees to monitor their feelings and raise awareness over climate change.
Have you already visited our Meat the Future exhibition? Consider this three course meal an introduction to what you may expect.
In March 2013, five days before Liu Xi and her husband Shen Jie were scheduled for the transplantation of one fertilized embryo into her womb, the young couple died in a car …
It’s been called China’s “pork miracle.” For centuries, pig-rearing in the country was predominantly a backyard occupation. (The etymology of the Chinese character for “home” …
It’s clear that driverless cars will revolutionize the way we get from Point A to Point B. Perhaps less obvious is how it’ll change our sex lives. According to a new study by the …
Today is Earth Day! This means that we think about the relationship between man, nature and technology, as technology is becoming a nature of its own. Acknowledged in 192 …
Meet the Shiva Therapist fro HUBOT. She massages with her own hands, but for the heavy work, she has four additional robotic arms at her disposal.
The Netherlands leads in cheese, clogs, and cultured meat. This sustainable and animal-friendly form of meat has largely been developed in our country. In 1997, Willem van Eelen …
In 2017, two years after her father died , Ira van Eelen decided to call the Dutch Arable Farming Union. She couldn't help but wonder how come the Netherlands was still not …
It was just little over a year ago that bike sharing schemes started to take off in China. Yet in the blink of an eye, millions of bikes painted in vivid colours, popped up in and …
Physics teaches us that it is not possible to be present at two places at the same time. However, some users of social networks seriously challenge that fact. The amount of …
Mon dieu! The swirling pile of trash in the Pacific Ocean is growing at an exponential rate. A recent study has estimated that the mass of the garbage island is four to sixteen …
For those experiencing symptoms of motion sickness in VR , it’s now possible to step inside a real-life simulation of what it could be like to ski on mars. Last week, desert dust …
Chernobyl is famous as the site of the worst nuclear power accidents in history. The 1986 disaster has come to represent the perils of nuclear energy, much as Hiroshima represents …
The story of money: an accessible roadmap from prehistory to digital age, from cows to credit, from gold mining to bitcoin mining. The final episode: bits.
The story of money: an accessible roadmap from prehistory to digital age, from cows to credit, from gold mining to bitcoin mining. This episode: plastic.
New technologies are changing the landscape, but the latest trend reshaping rural environments and agriculture is agroforestry: the art of planting trees.
The Ocean Cleanup claims its device could cut the size of the Great Pacific Garbage Patch in half in five years.
ADE Green returns for the seventh consecutive year to the DeLaMar Theater in Amsterdam. Once more, Amsterdam Dance Event organizes this leading event to ignite sustainable action, …
Hello meat lovers! In vitro meat innovator Aleph Farms has taken the saying 'one small step for man and one giant leap for mankind' to a whole new level. The startup has succeeded …
Hooray! The team of researchers at the Eindhoven University of Technology (whom we previously collaborated with to design a prototype for an artificial womb ) has been awarded a …
Technology is coming closer to us. In the form of decades old headphones or state-of-art devices. It has always been a part of our lives and this only seems to develop further: …
A breakthrough technology that responds to signals from the brain has transformed the life of a paralyzed 28-year-old man called Thibault. Four years after the initial incident …
You know climate change is real when dead coral Pokémon start to wash up on (virtual) beaches. Behold, Cursola, world’s first dead coral Pokémon. On the origins of Cursola While …
Some centuries ago landscape painters taught us to appreciate the quality of an untouched landscape. Ever since we have been doing everything to recreate it. We camouflage cell …
Welcome to the conversation! Every week, we’ll open up a new conversation among members of the network about next nature topics we've encountered around the globe. We hope …
Emma is in poor health. She has painful varicose veins, stress-related eczema, puffy skin, a grey complexion, red eyes and a hunch-back. She is an imagined office worker of the …
Summer is here and the sun is out, and yes, this is awesome. After a long day in the sizzling summer sun, you get a group of people together to share some delicious food, …
Bio design crosses the border between the ‘made’ and the ‘born’. Enabling living organisms as essential design elements, it brings us products that adapt, grow, sense and repair …
In the coming years, our material world will change dramatically. In parallel with climate change, our lifestyles will also change. It is becoming increasingly important to ask …
The world of fungi has attracted a lot of interest and seems to be becoming very fashionable of late. A new exhibition at Somerset House in London, for example, is dedicated to …
The current lockdown in much of Europe has city-dwellers flocking to the countryside to wait out the outbreak sweeping the continent. Seeking relief from coronavirus, urbanites …
A stack of pancakes ladened with syrup, a frothy latte posed next to a white MacBook, a deep pan pizza oozing with cheese. Instagram has made “food porn” – images that portray …
As our reality exists increasingly within digital realms, our virtual world demands a virtual identity. Our work is hybrid, our social identity is online and our connection is …
The rapid technological advancement of the human race has led to many consequences, especially regarding the integrity of the atmosphere that protects all life on Earth. Although …
This is #1 in our cyborg mythologies series, where we explore the cyborg as a historical being intertwined within mythologism, ancient religion and sacred iconology. A way to …
From mouse, to stylus, to finger: our virtual tactile perception has changed a lot over the years, just like our overall virtual experience. With new developments our virtual …
Imagine you’re in a hot air balloon flying over an African savanna in the late growing season. Below, herds of elephants, zebras, wildebeests and rhinos roam a mosaic landscape …
Water scarcity is among the top five global risks affecting people’s wellbeing. In water-scarce areas, the situation is grim. Conventional sources like snowfall, rainfall, river …
Utopianism and dystopianism are themes often found in today’s movies, especially considering the increased awareness of the damage done to the Earth by human activities. Often …
Globally, humanity consumes almost 350 million tons of meat a year. In the next 10 years, this number is expected to increase by a significant percentage. Scientists believe that …
As winter arrives, so does the season of giving. Good gift giving is an art and can be quite the endeavor at times. But don’t worry, Next Nature is here to help! We present to you …
Art not for people, but for insects. That is the goal of the Pollinator Pathway project by Alexandra Daisy Ginsberg. With her concept she wants to change the way we perceive our …
Sofia Crespo and Feileacan McCormick have made an AI-generated endangered species installation on Times Square.
Next time you are taking a walk to work, have a look around you. You will probably notice that most of your fellow pedestrians are glued to their phones, rather than enjoying the …
Technology brings us closer to nature, and indigenous insight reconnects us to our roots.
It's not every day that someone walks into your office with a shoebox, and even more rare when that shoebox contains a potential future.
To explore the public opinion towards cultured meat, speculative food designer Leyu Li created fictional influencer “Meaty Auntie” and turned to TikTok.
Sunshine, cocktails, and the lap of luxury; a yacht usually doesn’t seem to symbolize sustainability or charity. But this one might save the ocean.
The Netherlands is a real coffee country. With the amount of coffee Dutchies drink per year, they have been in the top 10 of most coffee drinkers for years. Drinking so much …
Your biggest wealth is health, but what it the costs you your anonymity? This vending machine gives you nutritional advice based on the information you give it.
As sea levels climb, coastal communities brace for floods and erosion. Artist Allie Wist asked herself: what will we eat in a flood-filled future?
Luke Talbot has developed a solution to assist people experiencing homelessness in charging their phones for free by hacking rental bicycles.
Heartsync is an interactive art installation crafted by artist Nino Basilashvili that syncs up your heartbeat with others.
It seems that traffic jams aren't just a problem confined to Earth's highways and byways. How did this happen? And should we be concerned?
Every ecology needs balance. So that's also true for the ecology of the office. The office is a ecology that is highly regulated: temperature, light, humidity, distance to other …
The sciences of biomimicry studies nature's models and then imitates or takes inspiration from these designs to solve human problems: Culture imitates nature. The Black&Decker …
Bioplastics are a form of plastics derived from plant sources such as hemp oil, soy bean oil and corn starch rather than traditional plastics which are derived from petroleum. …
Biosphere 2 is a manmade closed ecological system in Oracle, Arizona. Constructed between 1987 and 1989, it was used to test if and how people could live and work in a closed …
"A glowing green logo drawn by scientists on the wing of a genetically altered butterfly could herald the day that the insects are adorned with adverts and slogans . A team at the …
Crowd counter is a piece of software able to track moving features within a video clip. It works on the assumption that points that move together are most likely part of the same …
Die Natur verändert sich mit uns (English version: Exploring Next Nature ) by Koert van Mensvoort , published in Entry Paradise, Neue Welten des Designs, Gerhard Seltman, Werner …
More people than ever are asking to be buried or cremated with their mobile phones when they die. The trend, which began in South Africa, has now spread to a number of countries, …
Is this fake nature? Surely, it's nature altered by human hands. Somewhere in the East German forest these trees started to change color in autumn a little earlier than all the …
More than 70% of San Francisco's downtown outdoor space is dedicated to the private vehicle, while only a fraction of that space is allocated to the public realm. Park(ing) …
Despite the metaphor, current virtual desktops (a) have little resemblance to the look or feel of real world desktops (b). Bumptop explores making virtual desktops behave in a …
'Release' is a product that terminal patients can use to leave audio messages for their relatives, for after their death. People living with the notion that they will soon die …
A group of computer researchers from Amsterdam have demonstrated that it is possible to insert a software virus into radio frequency identification tags, part of a microchip-based …
The world's oldest profession has made quick inroads into virtual life. You can make a quick buck if you're willing to accept in-game money for sexual services -whether that's …
Luna Maurer has launched her long-expected website on december 18th 2006: From July 2005 a camera on the roof of De Balie (famous building in Amsterdam) is 'catching the sky' in a …
This concept is a cutting board that has an integrated scale within a defined area on it's surface. This allows a person to both cut and measure ingredients on the same surface …
In "A Hunt for High Tech", Bart Hess seeks to harness both nature and technology and create armoured skin and fur for a new human archetype incorporating animalistic and …
Oh yes, it's a car alright! A High Speed Amphibian . Simply press a button and drive into the water. The wheels automatically rise and as you press the accelerator nearly a tonne …
Animals do not shape their living environment as radically as humans, but why don't we give them some help. James Auger envisions animals, birds, reptiles and even fish becoming …
While recent developments in brain-computer interface (BCI) technology have given humans the power to mentally control computers, nobody has used the technology in conjunction …
Just follow the yellow brick road ... thin red cable and you know where to go! Instead of looking at a small 6 inch screen, or listening to less than exact turn by turn …
Compubeaver by Kasey McMahon "I am interested in the way we interact with nature. As we become increasingly reliant on technology, we become disconnected from our natural …
Henk Rozema displaying his invention (2006), the digital tombstone "Digizerk". It was only a question of time that global digitalization would be introduced on cemeteries. The …
Let's talk about hyperbreasts. Have you ever wondered why men like women with large breasts? Historically large breasts are presumably sexually attractive for men because they …
Apple knows more about clean design than anybody. But apparently their products contain hazardous substances that other companies have abandoned. Hence, green my Apple! Via …
Google Video is no longer in operation. Sorry for the inconvenience "It's a high form of masturbation" A RealDoll is a realistic life-size sex doll that cost more than an average …
The influence of modernism and its trend of thought that affirms the power of human beings to create, improve, and reshape the world, along with its clear universal style of …
Janine Benyus talks about biomimcry at TED (video) . Of course, we “like” her book and appreciate the concept of biomimcry (from bios, meaning life, and mimesis, meaning to …
Our image of nature is permanently under construction. For Dutch biologist Gerdien De Jong , this became al too clear after watching The Life of Mammals , a series of nature …
Edward Burtynsky is a photographer that makes pictures scarred or altered landscapes, changed by industrial activities. His work shows the disappearance of nature and the …
Mount Everest is the highest mountain on Earth, as measured by the height of its summit above sea level. In May 2005, artist Xu Zhen led an ascent on Everest, and succeeded in …
As our lives become more and more controlled by devices, we need ways to control them all. The pultius is the answer.
The VIBE - emotional sensing necklace combines conductive ink and textile sensors. The necklace can read multiple biometric signals of the wearer and communicates them to other …
A review by Djbroadcast on the Paradise by the Laptop Light event last week. Sorry it is all so Dutch. Wat betekent het begrip natuur voor ons vandaag de dag? We zien 'de groene …
Robotarium X , the first zoo for artificial life, approaches robots very much in the way as we are used to look at life in old nature. We, humans, enjoy watching and studying …
Although there are numerous researchers out there creating humanoid robots, none are as explicit about the close relation between anthropomorphism and narcissism as professor …
Another project by Oded Ezer, Typosperma is the second experimental typo project in his 'Biotypography' series. As a paraphrase on the biotechnology definition, 'Biotypography' is …
Remember the article N is for Nature , describing the Californian company Enologix, which creates software to predict how wine critics will rate a wine, so that it can be produced …
Everyone knows some foods have more calories than others. For many people eating turned into an information science, having to continuously read the amount of calories of the …
Seen in an article of Smashing Magazine . See also: Better than the real thing .
Avatarian Graveyard supplies a service for virtual addicts – people who excessively or compulsively spend time in virtual environments – to help them reintegrate into everyday …
Murata Boy, is a robot capable of riding bicycles unassisted. Balancing, pedaling and directing the bicyclee, turning the bike to avoid obstacles, etc. And this is his nephew, …
Let's face it: every time your cellphone battery runs empty you feel amputated and you quickly run back to your house to connect to a powering-adapter. Bionic Power Inc. is now …
With his Waterboxx , Pieter Hoff (The Netherlands) won the Bèta Dragons Award 2008. It is an instrument that supports plants and trees in order to survive in difficult …
Will Wright's hugely successful games SimCity and The Sims let players shape the structure of urban areas and the lives of virtual humans; his upcoming game, Spore , lets them …
Proctor and Gamble, the maker of Pringles , has successfully argued in a British court that their product is ‘not a potato chip’. Pringles are also officially now, not potato …
The Maldives, a chain of islands off the coast of India is taking the possibility of disappearance into account. This little piece of paradise is so low above sea level that it …
What is that growing on my car dashboard? Is that a tree? Indeed, Ford and Honda's next-generation dashboard instrument clusters feature trees (a vine in Ford's case) that grow …
According to the inventors of the dogpause bowl , slow eating dogs are happier than fast eating dogs. Having a dog in the first place is supposed to improve the quality of life, …
Now let us analyze this setup for a moment: You are looking at an avatar character inside a 3D model of a virtual reality cave, enjoying a 'natural' landscape – welcome in the …
Disney's Sleeping Beauty Castle could be the single best-loved structure in the world. Ever wondered where Walt Disney got his enchanting fairytale aesthetic? The castle, which …
Some days when we look in the mirror we like what we see, some days less so. Would it not be great to be able to tweak the image a bit? After all, it is our main manifestation to …
The Fake for Real Memory Game playfully visualizes the classical theme of Fake vs Real. Is everything that was once directly experienced, in our media society now replaced by …
GRONINGEN (NL) – Low-income people in the Dutch city Groningen should be able to buy a flatscreen television, according to the alderman of social affairs Peter Verschuren. The …
Shot taken before the robot in question short-circuited and started to kill all humans in sight.
A million years from now that hand would probably look more evolved, but the idea is nice: What if we would mold objects of the now into stone or bricks to preserve them over time …
European biologists have constructed a genetic map of Europe showing the relations between its various populations. The right part of the map shows the location in Europe where …
This weeks peculiar image gives gaming that "natural" touch: the Hemp–Mote by dhrek.com Made from 3 kinds of 100% natural hemp string on the outside, while remaining 100% …
This Honeycomb vase was made from a vase-shaped hive that 40.000 bees colonized for one week, building a hexagonal comb to encompass the existing form. Created by Studio Libertiny …
This weeks peculiar image is a work by Zeger Reyers. In 2001 he vaccinated some everyday objects - found in the basement of Rotterdam Art Centre Witte de With - with oyster …
Why hunt? Why gather? Join the Neolithic revolution! Somewhere around 9500 BC proto-farmers began to select and cultivate food plants with desired characteristics. While in their …
Our peculiar object of the week is the 'Kokon Chair' created by Dutch designer Jurgen Bey , who wrapped existing chairs with tight, elastic synthetic fiber resulting in a highly …
Too much carbon emissions warming up the planet? No problem: just bring the stuff back to where you got it from in the first place. Experts have been advising to bury carbon …
In 2008, for the first time in history, more than half of the world's population will be living in towns and cities . By 2030 this number will swell to almost 5 billion, with …
PacMan's skeleton is our peculiar object of the week. It was created by Le Gentil Garcon , in collaboration with Fransois Escuilia, palaeontologist, from the comparative …
Did you know there are more plastic flamingos in the USA than real ones? Plastic flamingos are widely considered to be the stereotypical example of lawn kitsch – the American's …
At a recent Yo-Yo Ma concert at the Detroit Opera House, Honda's ASIMO robot took the stage and conducted. Blame Honda when the robots take over. Thanks Paul .
In 1921 the word "Robot" (meaning "labor") was introduced by Czech writer Karel ?apek . In his play "R.U.R." (Rossum's Universal Robots), robots seem happy to work for humans. …
WARNING: Spending too much time behind the computer, may cause the leaking of elements from the digital environment into everyday life. Self control freak Olivier Otten is …
This lecture by Marxist philosopher Slavoj Zizek – never mind the crappy sound & image quality: this is philosophy folks! – should provide all next nature explorers with a …
Meet midori-san , the first blogging houseplant! Through sensors connected to the leaves of this Sweetheart Hoya reads bioelectric currents through the plant, this gives …
Tru Blood is a synthetic nutrient for vampires that completely eliminates the need to seek sustenance from any living creature. Packaged as a consumer good at your local …
What would it be like if the communication on a social networking site like Facebook was actually played out in everyday life? Hilarious sketch by Idiots of Ants (thanks Martijn ).
Never thought I would ever empathize with a hermit crab. But somehow the 'situation' the creature is in, provides me with a feeling of recognition. According to this video marine …
Nature used to be an unpredictable place of mystery. Fascinated with nature’s untamed wildness, artists created animal and floral patterns as a celebration of this phenomenon of …
Tasty realization of the classic Apple rainbow logo, made entirely out of fresh fruit. The clever creation was made by Richard Thomas from sliced kiwis, bananas, oranges, …
This video shows the first beta version of TwittARound – an augmented reality Twitter viewer on the iPhone 3Gs. It shows live tweets around your location on the horizon. Because …
Most people know about light emitting organisms such as jellyfishes, fireflies and mushrooms . Some time ago, genetic engineers transferred genes responsible for the luciferin and …
Male - BMW, Armani, Durex - is looking for a Female - Dolce & Gabana, New York Times, Victoria's Secret. Branddating.nl is a (serious) dating site that relies on the …
Jim Reinders, an experimental artist with a history of using curious media, became so enthralled by the beauty of the famous Stonehenge in England that he had to recreate it. …
I love this parody of the famous Shepard Fairey Obama poster by Mike Rosulek .
By DAVID BARBOZA SHANGHAI — China made public on Tuesday regulations aimed at cracking down on the use of virtual currencies amid worries that a huge underground economy was …
Coca-Cola© succeeds in what most NGO's try to achieve: getting the goods to the poor in the 3rd world Africa. For most people there, a Coke is easier to get and cheaper than a …
A mother takes her sick child to the doctor. Who, after careful investigation, concludes the child has a 'virus infection'. The kid is offended and shouts: "But Doctor! I am not a …
Regular readers of this website know we are keen to speculate that our global financial system is best perceived as an ecology, which although originally constructed by man, has …
How to navigate the urban jungle? Adopting the metaphorical image of a dandelion in flight, Dandella is a GPS device that shows you the way. Inspired by how young sunflowers …
It is a well known secret that plastic hardly breaks down and almost all of the plastic ever made still floats around somewhere . With the great pacific garbage patch now twice …
Image: A. Sidorov Have you ever fantasized about creatures which carry the biggest smile? Or creatures which are so deeply covered with fur that you wish they were real? Good …
Reliable data on economic growth is hard to come by in many parts of the world, especially in developing countries. Yet according to scientists, outer space offers a new …
Data-hungry companies like Google, Microsoft and Amazon could reduce their energy consumption with 40% by rerouting data to locations where electricity prices are lowest on a …
Old nature provided us with a wide variety of food: fresh milk, crispy vegetables, nutritious meat. Yet this is not enough, we want more: We want a printed steak , square …
Delicious retro-future meat from Japan. Food technology in the overdrive. Japanese researchers successfully cloned what is believed to have been the forefather ox of Gifu …
A future in which prosthetic patches prevent bodies from aging? Or a sexists view on femininity in robotics? Either way, the question is whether they are up- or downgrades of …
‘Advertising is the cave art of the 20th century’, Marshall McLuhan said. Advertisings are mythical depictions of hunting and gathering rituals, that don’t take place on some …
Filippo Minelli envisions Google total world domination in his very own stickery manner. See also: Google tracks flue via sick searchers , Google 2084 , Google DNA , Google …
In the future, every street will be a Nokia street? Perhaps not, however we may expect some changes in street signage due to the arrival of mobile & gps technology. Once …
I'd like to plea for more trees in soccer-stadiums: 1) They add an element of fun to the game; 2) They don't get aggressive easily; 3) Everyone supports green . Sebastian …
John Hart, assistant professor of mechanical engineering at the University of Michigan, is inventing techniques for growing carefully structured forests of high-quality carbon …
No silly. Of course sneakers can't be grown from transforming Koi Karpers. This is merely an fictional piece by Yoske Nishiumi. But then again, do you have any idea where your …
Now here is an experiment any one can do at home: Look around in your house and try to find a consumer product of which you know where it was made and by whom. Got any? Indeed, …
Imaginary advertizement for genetically engineered hybrid hyperfruits featuring an 'limwi', 'kiwange' and a 'strawblackberry'. Imagine a taste of things to come. Makes you want to …
DNA evidence has been the most bulletproof evidence for forensic sciences in recent years. Not anymore. A laboratory at Nucleix, a life-sciences company, has demonstrated it is …
The Eco Pod is a experimental design proposal towards the production of clean and renewable energy, which should operate in old, abandoned buildings. Pending an eventual recovery, …
Unsure how this melting polar bear ice sculpture created by artist Mark Coreth fits in Next Nature mythology. The art piece was presented last week in Copenhagen and is sponsored …
Beautiful images by Mikel Uribetxeberria, I think that he also made videos out of this work. Or I saw something exactly like it in a gallery in Chelsea. Gimme more
Remember the Gameboy Bricks by Gijs Gieskes? The same vibe must have been picked up by Christopher Locke (Chicago, US) as he opened his Modern Fossils Shop with many more peculiar …
Fountains are peculiar objects: We associate them with nature even though they are typically entirely artificial and man-made (unless you are living in Iceland of course). …
" A DVD with over twenty visions of artists, scientists, designers, filmmakers and thinkers who present their powerful imagery, radical ideas and visionary statements on how we …
(Not a tourist-pic from North Korea) In January this year, at the World Future Energy Summit in Abu Dhabi, Prince Willem-Alexander of the Netherlands said: "(...) My wife and I …
Recently were introduced, the OOMouse ... ...and the Magic Mouse . Both tools are developed to browse the ones and zeros more easily. It almost seems unfair to compare them, so I …
Rock 2007. Peculiar image of the week by Hans Wilschut . Made in Shanghai. If you know more about the orgins of the building: let us know. Thanks to Vivid Gallery , Rotterdam, NL.
It is nature, but not like we know it when chairs biomimic the pelvis. This anatomic Ruby rockingchair was designed by Pouyan Mokhtarani , Tehran (Iran). Via b oingboing.net | …
Buttons are everywhere: throughout your day you press them on phones, alarm clocks, keyboards, elevators, dishwashers and of course on the computer screen. Although buttons did …
In this simple but effective guerilla poster action by Moiré , stacks and pillars were disguised as sycamore trees to give the streets of Tokyo that ever so natural look. …
Today browsing and gaming is dominated by the shortcomings of machines, for machines simply do not know who is on the other end. Man needs to interact; therefore man needs to …
Getting information as fast as possible and on the spot is the trend. So what could be more direct than having information fired directly into the eye? Today - together with his …
Fashion has a natural cycle of its own, which is more dependent on market and media forces than seasons or weather. Trends are predicted, recycled, set and followed. Seasons in …
Although this TED video has been all over the web and commented on this website already, it still deserves a separate post: Desigineers Pattie Maes and Pranav Mistry of the MIT …
This remarkable proposal for a steam powered street locomotive was invented by Mathewson in 1876. According to the inventor the goal was to make a machine resembling a horse in …
The products in the fourth category don’t necessarily provide the consumer with a natural feeling. Their biomimicmarketing revolves around the claim to be ‘friendly towards …
A retail lot in Austin, Texas recently sprouted a field of solar photovoltaic sunflowers that soak up the sun’s rays to provide shade while generating a steady stream of …
Austrian designers Katharina Mischer and Thomas Traxler have created a solar powered machine that makes arrays of furnishings that vary based on how much sunlight it receives over …
Using ultrasound technology, researchers at the University of Tokyo have developed a holographic projector that displays three-dimensional virtual objects you can feel with your …
An earlier post on this blog already displayed the possible future of sight using augmented contact lenses. Researchers at MIT take this second sight to a next level by …
According to research carried out by scientists from the Columbia Environmental Research Centre , sewage water containing hormones and pesticides caused by human consumption is …
The American Chemical Society is holding a contest seeking short videos that answer the question: "What is nano ?" UC Berkeley graduate student Patrick Bennett and his colleagues …
Quote Eric Horvitz : "After finishing my doctoral work, I returned to Stanford Medical School to finish up the MD part of my MD/PhD. During one of my last clinical rotations, I …
Peter Cook and Becky Northey are tree shapers. Their designs are so ten years ago ; but still worth a post. Materials used: water, sunlight, soil... and a sprout planted in 1998 …
These photos of disused newspaper racks in a San Francisco storage yard – taken March 13, 2009 by AP/Noah Berger – are pretty much all you need to know about the state of the …
This translation of the essay ' Real Nature is not Green ' is a special treat from and for our fellow Next Nature explorers in China. We thank the people of the Microwave …
Kasey McMahon and Derek Doublin demonstrate the tension between people and their environment through the eyes of its non-human inhabitants. Beware of the Virtual Squirrels ! The …
Techno-artists love insects. Especially their unpredictable behaviour. Eindhoven (NL) based design studio Ehdv used tracking software and connected some camera’to a bunch of wood …
Over the past few months there has been a lot of commotion about the BP oil spill that happened in the Gulf of Mexico. It is considered as the largest offshore spill in U.S. …
What happens when brands have sex and make children? The Nike Dunk SB Heineken were a hit amongst sneaker-wearing-beer-drinkers, but unfortunately the child was unofficial. …
A while ago a plan was proposed within the European Union to add a “Three Strikes, Out” law regarding to copyright infringement. After three accuses of copyright infringement by …
Only for the title already I wanted to post this as soon as I read it on Nature.com. The newsarticle is entitled " GM crop escapes into the American wild ." Brilliant! Let's walk …
Why do we grow attached to things? Patricia Piccinini captured it well in this peculiar work: The Stags - 2008 (Culture becomes nature) The Nest - 2006 Thicker than Water - 2007 …
According to this fictitious future medical bill almost every part of the human body will be repairable in 2028. Gut bacteria replacement, Bone tissue growth for skull repair, …
The Swedish design group Front brings the principle of the digital computerdesktop trashcan back to the physical world. When your trashcan basket is full it bulges outward. When …
Experiments in the Revival of Organisms is a 1940 motion picture which documents Soviet research into the resuscitation of clinically dead organisms by Doctor Sergey Sergeyevich …
Language is communication technology. As Marshall McLuhan said, the spoken word was ‘the first technology by which man was able to let go of his environment in order to grasp it …
Now here is an example of the fusion between the made and the born , most kids would crave for. Much better than the robotic dino toy. Designed by evolution! Hopefully this …
We would call this a sustainable technology if only the average pet's carbon footprint wouldn't be comparable to that of an SUV .
These two co-workers found out the face tracking feature of the utterly advanced HP webcam will not recognize or track black faces. Hewlett Packard says it's because the program …
As technology progresses we constantly have to adapt ourselves to an ever changing media landscape. Designers try to smooth the changes with a ' progressive nostalgic ' strategy: …
Following in the footsteps of a Marco Polo-esque spice trade, next nature explorers Jon Cohrs and Ryan Van Luit travel by canoe past massive cargo ships and factories in search of …
So, you are aware biotech will drive our evolution , you took the crash course on synthetic genomics , you've got your map of the DNA world in your backpack and are now eager to …
Sometimes you come across something that is not directly related to Next Nature, but só well made that it deserves a place on this website. Logorama, a 16 minute animation by the …
"Have you seen my stapler? No, but just look it up on Google home office maps ." CSIRO Researchers have developed miniature sensors that track lab equipment, coffee mugs and …
Multi-touch designer and developer Richard Monson-Haefel considers sound as an important part of our user interfaces. As an application of " Calm Technology " which revolves …
Are we creating the penicillin or the asbestos of the 21st century? In the months preceding our Nano Supermarket Project , we share some speculative nanotech products with you. …
During the selection of the top ten of next nature movies we’ve doubted quite a bit between the Truman Show (1998) and American Beauty (1999). The Truman Show tells the story of a …
Recently some scientists in Britain have recommend planetary ' geoengineering ' to avoid climate change. And as politicians are listening , it is time to explore the options. New …
Nomadic Plants are a species assembled from a group of robotic-electronic-biological organisms living in symbiosis in order to survive in habitats affected by human activity. The …
Martin Heidegger and Marshall Mcluhan already described people's tendency to extend their identities in the animate objects when interacting with them. When for instance, driving …
Recycled island is a research project on the potential of realizing a habitable floating island in the Pacific Ocean made from all the plastic waste that is momentarily floating …
These SMS-style messages scribbled into the mountains by Belgian artist Wim Delvoye , make us so humbly aware of the discrepancy between our everyday human experience and some of …
Researchers at the Marine Biological Laboratory at Wood's Hole, Massachusetts, are testing a plan to train fish to catch themselves by using a sound broadcast to attract them into …
During the 1960s, monkeys were sent into outer space as part of the US space exploration program. But they didn’t all return, until now. Via scaryideas.com | Related: WWF
Inspired by body language of animals (in particular squamates and porcupines), designer Jop Japenga created a headphone with an adaptive skin that responds to the music played on …
According to the World Health Organization (WHO), unhealthy diet is amongst one of the leading causes of the major non-communicable diseases. Can design encourage people to …
Nowadays buttons are completely mundane and natural objects in our environment. You find them on phones, alarm clocks, keyboards, elevators, dishwashers and of course on the …
Printer ink is assumed to be the most expensive liquid on Earth. If you believe the many websites that quoted the figure above. But little research learns that this is figure is …
During the riots of 1968 , as students in Paris ripped up paving stones and threw them at the police, one of the rallying cries was “sous le pave: la plage” (under the pavement: …
Resource-poor Japan discovered a new source of mineral wealth: sewage sludge. In its first month of operation, a sewage plant in Japan’s Nagano prefecture has mined 5 million yen …
"Owning the Weather" is a documentary about geo-engineering by Robert Greene. It's about whether or not we should engineer the weather and the different impacts that this has. …
Anyone who ever saw an x-ray picture of himself will probably recognise the uncanny feeling of staring at your own skull or bones and being confronted by one of nature’s grim …
Where religions promise their believers a life after death and cryonics also needs a kind of belief in future technological development, designers James Auger and Jimmy Loizeau …
Catalytic Clothing is a fashionably calm technology that aims to tackle air pollution by embedding a substance in the clothing that purifies air when you wear it. The purifying …
Some blackbirds have found city living so much fun (the theater scene! the restaurants!) that they have given up migrating south for the winter. Cities are usually warmer than the …
Renegade architect and futurist Rachel Armstrong has proposed that our cities, currently constructed of dead trees, baked mud, and refined ore, need to be coated in a layer of …
Our food production is much more technological than we typically realize. My appologies for disturbing your trance; I realize that sometimes you'd rather linger in the illusion. …
Has this tree gone Pac-Man on the power lines? In truth, the slice through the side of the tree is the work of 'utility pruning.' Topiary was once determined on entirely aesthetic …
Do cars have a face? You would be inclined to say yes immediately. And you would be right as well, because they do. Study has confirmed through a complex statistical analysis that …
Bionic horror by designers James Auger and Jimmy Loizeau , who have created a clock that traps insects on flypaper before depositing them into a vat of bacteria. The resulting …
In a vivd example of the blur between culture and nature, players using an online game called Foldit have helped solve complex questions for researchers about enzyme models. The …
Some beautiful images from games gone wrong. If you have more of them, post a link in the comments Via
Maybe you still remember the tattoo which helps to monitor a diabetic’s glucose level. A permanent solution. Now Japanese scientists from the University of Tokyo created a new way …
Can art change perceptions more than drugs? An art project which was on show in Berlin’s Hamburger Bahnhof allowed 12 free-roaming reindeer in the former railway station creating …
The rock formations in the High Altitude photo series don't exist physically, yet they are very present in our society of simulations . The photos visualize the development of the …
At Cornell Creative Machines Lab they were curious to see how two "chatbots" would make conversation. Powered by Cleverbot , created by AI researcher Rollo Carpenter, the robots …
Architecture has now come to a stage where the technical possibilities seem limitless. Buildings become more fluent, dynamic and organic. Examples can be found in most buildings …
Always wanted a pair of kitten ears to express your feelings to the world? Well, you probably never thought of that – as you have to be a Japanese genius to come up with such an …
Indulge in its cuteness. The Labradoodle brings us the finest blend between the labrador and the poodle. Combining sociability with beauty, they are the perfect human companion. …
Recent flooding along the Mississippi River has broken records first set 70 years ago. As always, it's hard to attribute local weather to global patterns, but the heavier rainfall …
Our peculiar image of the week is not what it seems. Rather than a man with a gigantic chicken on a leash, you are looking at a normal chicken with an incredibly shrunken man …
Stanford researchers are developing 'biotic games' involving paramecia and other living organisms. So far, they have created three games that mimic classic video games. The …
This interview from 2008 is exemplary for a time when people started experimenting on humanizing anonymous avatars in the virtual realm. Shopping, building, going on holiday, …
Nobuhiru Takahashi, student at the Kajimoto Laboratory of the University of Electro-Communications in Chofu City, Tokyo, invented this Internet French kissing device. When a …
We all know the cellphone masts disguised as trees , created in an attempt to blend technology within the 'natural' landscape. Now Taiwanese scientists have created trees that …
A scientist in Mysore, India has figured out how to color-code his backyard ants. Mohamed Babu's wife noticed that the ants' abdomens turned white after drinking milk, so it was …
I've noticed DNA spray notices springing up around Amsterdam. I assumed it was a fairly standard anti-theft device: A crime is committed, a little nozzle is activated by the …
Named after the story of a city girl that washes her hair with pine-needle shampoo and one day walks in the woods with her daddy says "Daddy! The Woods Smell of Shampoo", this …
The Animal Architecture Awards have just announced the winners of their 2011 contest. Taking first place is Simone Ferracina's Theriomorphous Cyborg , a (speculative) augmented …
When watching a science fiction flick, it can be hard to determine what time in the future it is set, although this is a usually an integral part of the movie. However, it is …
Researchers learned that city birds have larger brains relative to their body size. No, they are not getting big-headed from their exposure to big-city sophistication, but rather …
Like with pets and babies, we seem to like it when devices mimic our behaviour and social patterns. In the process of domesticating technology, we teach products to behave like …
Blood Wars is an art-science installation that will pit white blood cells from two different people against each other in a "tournament" that aims to see which person has the …
For centuries the Dutch landscape has been known for its highly cultivated formal structure, however with the introduction of Google Maps a whole new layer of formalization has …
Part 9 in the 11 part series Anthropomorphism and Design . With most products, one wouldn’t normally worry about the environment that it enters. However, anthropomorphic products …
Elon Musk, the chief executive of spacecraft company SpaceX, believes we need to reinvigorate popular interest in space colonization, not just to boldly go where no man has gone …
A delicious Montepulciano in only 6 seconds? This is now possible with the universal Nano wine. All you need is a microwave oven. In 5,64 seconds at 1000 watt you have a sublime …
As mentioned earlier , the world seems obsessed with algae. Not limited to producing light or energy , algae has also found its way to our plate as a new vegetable, and maybe …
Interpreting the plastics in the Earths ecosystem as building material rather than as waste.
Try it once. Go stand near a highway, close your eyes and listen carefully. Hear the sound of tires on the asphalt, hear the rhythmic ‘sshhh’, focus on this particular sound. And …
Remember those long gone times when babies were delivered by white storks ? Today they are simply downloaded into mom's belly. How superhandy! Apparently every era creates its own …
Certain types of bacteria can navigate using magnetic nanoparticles as tiny compasses. Researchers at the University of Leeds have extracted the protein that controls this process …
There is a new version of the well-known cellphone masts disguised as trees. Instead of adding fake nature to these masts, ChamTech Operations wants to put a layer of invisible …
Birds use whatever they can get their beaks on to build nests, including cigarette butts. Surprising new research from the Universidad Nacional Autónoma de México shows that …
Today, shoes have been naturalized to the extend that we hardly can imagine life without them. Yet, shoes didn't exist in old nature, hence there must have been a day when …
Although chocolate milk producing cows may sound silly, scientists are seriously analyzing the feasibility of the idea. Why not add genes of cocoa and sugar to a cow, in order to create a cow that produces sweet chocolate milk?
The Kitchen Meat Incubator does for home cooking what the electronic synthesizer did for the home musician. It provides its users with a set of pre-programmed samples that can be …
Remember Lucy McRay's swallowable perfume ? Well, now you can buy it. Annu Alpi has developed a piece of deodorant candy which presumable makes women smell like roses for up to …
wrote 19th-century scientist and philosopher Hermann von Helmholtz. It was Helmholtz who inspired body-architect Lucy McRae to create Morph?.
The United States Food and Drug Administration recently approved Elelyso, the first drug to be grown in genetically modified plant cells. Produced in carrot cells, this drug helps …
In vitro meat has been billed as a way to end animal suffering , put a stop to global warming , and solve the world's insatiable demand for animal protein. There's no doubt that …
Canada-based Okanagan Specialty Fruits is pitching a genetically engineered apple that does not turn brown when bruised or exposed to air. This new technology, available in both …
They might not be as fast, but goats offer several advantages over diesel-powered lawnmowers. They're quieter, they emit fewer greenhouse gases, and they fertilize soil as they go …
Finally a vending machine that doesn't want you money, it wants hugs. Embrace it to get a free can of coke. Might give you rushes of anthropomorphobia too though. Via The Pop-Up …
Peak oil, the point when petroleum extraction is at its maximum, may have already occurred sometime in the last few years . Not only affecting whether we drive a Humvee or not, …
Designer and former fashion model Barbara de Vries was cleaning plastic litter off her favorite beach in the Bahamas, when she noticed the plastic fragments were all uniquely …
Dutch designer Boris Rijksen experiences a culture shock when he enters the real world after a day of screen work. Before, the ‘digital immigrant’ struggled to understand digital …
Nowadays the human impact on our planet can hardly be underestimated. Climate change, plastic islands, genetic manipulation – ‘We were here’ echoes all over. Yet, every now and …
Last week, the young and talented designers of the Next Nature lab at the Eindhoven University of Technology presented their end of semester works in an internal exhibition. There …
As the NANO Supermarket opens discussions on the ethics, purpose and usability of nanotechnology, Frederik De Wilde is researching its artistic possibilities. De Wilde is a guest …
The Namib desert gets less than a half an inch of rain per year, yet the stenocara beetle manages to survive in these punishing conditions. The beetle's secret lies in an array of …
In an analysis of Caldecott Medal winning children's books, sociologist Allen Williams recently discovered that depictions of nature have dramatically declined from 1938 to …
Though disgusting, sewage is an abundant, nutrient-rich resource. Researchers at the University of West England have taken advantage of this fact by creating a robot that turns …
Volvo cars is testing a new safety system that automatically hits the brakes once an animal is detected in the vehicles vicinity. The Animal Detection System expands the range and …
I didn't need to insert a coin before collecting my refreshment!
Rayfish CEO Raymond Ong recorded a video response in which he analyzes the controversy around his genetically engineered stingray leather sneaker. Highly recommended for nextnature connoisseurs.
Feeling grumpy and hungry? Unfortunately, the University of Tokyo's Happiness Counter refrigerator won't open up until you give it a big smile. The concept is based on the fact …
Tokyo University of Electro-Communications , revealed SHIRI (? = "buttocks"), a "Buttocks Humanoid That Represents Emotions With Visual and Tactual Transformation of the Muscles." …
For past entries and an introduction to the 11 Golden Rules of Anthropomorphism and Design, click here. People expect many things from each other: Expect them to say hi in the …
In this particular piece of video art, loyal readers of nextnature.net might recognise the building as Zeche Zollverein in Germany, where we organized the Biggest Visual Power …
Montreal filmmakers Mathieu Roy and Harold Crooks’ documentary feature, Surviving Progress presents the story of human advancement and reveals the risk of running the 21st …
In 1994 researchers at Ohio State University created two artificial wetlands* in riverine basins in order to investigate their possible benefits, and whether they could replace …
At Next Nature, we often argue that "our image of nature as static, balanced and harmonious is naive and up for reconsideration ." Paleontologist Peter J. Ward happens to agree. …
We're used to seeing proposals for high-tech vertical farms that never seem to translate to real life, but the city of Linköping in Sweden has finally taken these buildings out of …
What do blueberries have in common with sugar, corn cereal, modified food starch, partially hydrogenated vegetable oil, artificial flavor, cellulose gum, salt and and Blue …
Christien Meindertsma was surprised by the unrealistic nostalgic visualizations of farms on children's coloring plates. She decided to create a more realistic coloring plate of the pig farm.
FabCafe in Tokyo offers a sweet new way to make self portraits.
The eBird app is bringing big data to bird spotting.
3D printer company MakerBot recently launched a contest inviting designers to create the birdhouse of the future. The winner is The American Craftsman Bungalow by Brent J. …
Earn points in an online game by destroying real-life CCTVs.
Vegetarian food products typically mimic existing meat products. The meat flower reverses this principle.
In a time of all-horse hamburgers and E. coli outbreaks, food provenance has become a huge issue. Consumers are becoming increasingly aware of the lack of traceability within the …
Big bugs make big bucks for Chinese farmers turning to roach ranching.
Drones are the mosquitoes of the 21st century. A small town in Colorado will be voting on an ordinance for drone hunting licenses for shooting down the wild robotics.
Is a colorized antique photo more or less "real" than the original?
CouchCachet promises to give you the fully-booked, in-the-know life while you are on the Sofa.
Amazon announces they want to use drones to deliver your order within a half hour at any location you choose.
QR and barcode tattoos turn an artist's body into a business card.
Before we can decide if we are ever willing to eat meat from the lab, we need to explore the food culture it will bring us.
The honor of naming this new monkey was auctioned off to raise funds. The monkey is now know as the Goldenpalace.com Titi.
The world is returning to the era when a scraped knee or ear infection could lead to sudden, swift death.
Putting the birds into the bird's eye view of Google Maps.
Need a personal trainer? Google's new sneakers fulfill the role of a human coach.
Wine and bacteria combine to make seamless clothing.
Science Gallery is calling synthetic biologists, bio-artists, bio-designers, amateur biotechnologists and bio-hackers to submit proposals for projects for their upcoming flagship exhibition GROW YOUR OWN.
Not real, but a far more creative way to deal with unsightly public works than tree-shaped antennas . Via Gizmodo .
Polar bears bring only $9 million to the Canadian economy, but citizens put their collective value at $6.3 billion. Why?
From the earthquake in Haiti to Hurricane Sandy to the Boston Marathon bombings, Facebook, Twitter and other social media were used to spread information and help citizens and …
A global wine shortage is looming. Never fear: Next Nature has a solution.
$220 ice cream glows thanks to synthetic bioluminescent proteins derived from jellyfish.
Retro futuristic vision from the sixties: "The menu is given to the automatic chef via typewriter or punched computer cards."
For those who "eat meat, but don't like in-vitro meat, because it is so unnatural" . Please spend 5 min to watch this video and change your thinking. You were watching the …
One would need a gardening robot, fitted plant species and some kind of dome structure for the plants to grow in.
Minsu Kim created a wonderful series of living dishes that wiggle and wave on your plate.
The Mammoth was the last of the giant land mammals of the Pleistocene era.
By the turn of the century, some people began raising questions about our meat consumption habits.
Ever curse the fact that you have to wait hours to sober up after a night at the bar? Now, you can sober up almost instantly – that is, if you're a mouse. Researchers at MIT …
A society of dog owners who have no problem giving free reign to their pets' killer instincts.
The News Machine is a contraption that explains the news distortion that happens when a message is broadcast through different media. The starting point is a tweet sent from a …
Thanks to evolution goats can climb, shifting their ecosystems to the trees.
Indulge in the Next Nature stump speech at TEDx from Dr. Van Mensvoort
Only genetic engineering can stop citrus from going commercially extinct. But is the public ready to accept GM orange juice?
An artist envisions our consumer electronics in a century, moss-covered and half-decayed.
The Alternative Limb Project makes beautifully fake artificial limbs.
With each swipe of the razor or rip of the waxing strip, the world has unwittingly been massacring one of its most familiar species. In what may be the first extinction caused by …
Robots use swarm intelligence to rebuild coral reefs.
A new game lets you play chicken with your life on Facebook.
Manipulations of the mind that were once the terrain of futuristic fantasy are now one step closer to becoming reality. Scientists at the Massachusetts Institute of Technology …
The surprising reasons why squirrels are so abundant in city parks in the US.
Many people don't know that growing and cooking in vitro meat is a decade old.
Finally a full anatomical model of the renowned comic figure.
The gumboot chiton snail produces the hardest biomineral known on earth - and it may hold the secret to better nanotechnology.
Scientists are using Twitter, blogs, and news sites to categorize the global psyche.
Injecting mice with telomerase enables them to live 24% longer than the average mouse.
This Bolivian monkey's name is also an ad for online gambling.
A (very) short history of a century's worth of "disembodied" meat in fiction.
A "breathing" desk that reminds you to change positions throughout the day.
Concerned locals are turning Detroit back into farmland and forests.
A hotel where all communication is conducted by Twitter hashtag.
UltraHaptics is a system for creating haptic feedback in mid-air, offering new kind of interactions with our touchscreens.
The visualization of every known drone attack in Afghanistan and Pakistan.
"The birds are in misery. I don’t think they sing, they just screech in pain"
Our language preserves evidence of a type of food that's all but extinct.
Do you get lost in shopping malls? Do you end up spending more than you intended? It's not your fault.
An artist visualizes WiFi waves across landmarks in Washington, DC.
Think you know your corporate animals? Show off your knowledge and win our Next Nature app!
The more iconic video game audio track played with an ancient woodwind. The resulting sound is pure 1980s nostalgia.
CGI video of animals doing crazy stunts makes us realize how peculiarly creative humans really are.
Next Nature Network will take part in the Deutsches Museum exhibit "Welcome to the Anthropocene: The Earth in Our Hands".
Scientists designed artificial cells built from silicon, able to copy basic functions of life.
Buoyant Airborne Turbine is a giant high altitude wind turbine that brings low cost energy to remote areas and off-grid sites.
There is a similarity between strings of binary and strands of organic DNA: they both carry actionable information encoded into reconfigurable symbols. Using nature’s biodiversity …
Aagje Hoekstra has developed a bioplastic made of of dead beetles called Coleoptera.
Besides finding their way, people look at to transport them to another place, or in this case, another perspective on planet Earth.
The Western Corn Rootworm has evolved to eat genetically engineered corn, designed to kill it.
Painter Stephen R. Kutcher uses different insects to create unique paintings.
Indian fragile DIY electronic infrastructure gives an insight into our complex electronic wire systems.
If this technique become widely accessible it could allow you to regain anonymity in webcam and facetime conversations.
World's first self-regulating artificial heart transplanted in France.
Google Maps drew up three different topographical plans of Crimea: one for visitors from Ukraine, another one for Russian users; and the third on the international version of the …
Kids go crazy for the crispy flavor of cutting-edge science.
These delicate structures, reminiscent of fish roe or tapioca balls, are filled with lab-grown animal fat.
Lab-grown marrow bones lend meaty notes to vegetarian soups, and taste delicious when roasted and spread on toast – no stone bludgeon required.
Many people dismiss lab-grown meat as slick, soulless and completely artificial, but rustic in vitro bioreactors bring artisanal production methods back to cultured meats.
As ocean-based oyster beds have all but vanished, in vitro oysters may prove an exquisite alternative.
An artificial illumination that is "authentic" enough to replace natural light.
So, you are well aware that biotech will drive our evolution , you took the crash course on synthetic genomics , you’ve got your map of the DNA world in your backpack and are now …
Portraits of people who live alone in the forest.
A map showing the endless expansion of McDonald’s restaurants.
Scientists succeeded in implanting non toxic nano-motors into living cells.
Hydrating 'Skin': giving a second life to damaged skin.
Sneak peek into your nano future with the brand new NANO Supermarket TV Commercial.
Plastic can fuse with rocks to form a new material: plastiglomerate.
Realistic WOII movie Fury had to cater to the gaming generation with hyperrealistic Star Wars style laser shooting tanks.
On the 5th of August, one year after the lab grown hamburger, the In Vitro Meat Cookbook was launched.
This 3D Grass Printer can print a garden in any shape you can imagine
The oPhone and oSnap allow you to send pictures with aromatic vocabularies.
Sexy girls and organ meat was never a good combination to me, but the people from Black Milk Clothing that created this swimsuit seem to think it makes a pretty nice product. Am …
Smart Tags stick to containers of food and change color when something has expired.
Solaris gives participants the power to control a pool of magnetic fluids with their brainwaves.
After death you could have your ashes made into a rock to form the base of an “eternal memorial reef” .
Company AMSilk will commercialize spider silk in 2015.
The desire to avoid face recognition algorithms could bring us a whole new set of make up styles,
The first 3D printed house is a recognisable and attractive Dutch Canal House, an exhibition and building site in the heart of Amsterdam.
The first Zero-Waste Grocery Store "Original Unverpackt" will open this summer in Germany.
Mogees: the device that can turn everyday objects into unique and unusual musical instruments.
An abandoned shopping mall became a self-sustained urban aquarium filled with thousands of fish.
These pictures by photographer Jacob Gesink show how the urban green is carefully manufactured.
Kids try to figure out what the "prehistoric" Walkman is and how it works.
When a floppy disk becomes a 3D printed save icon.
Super Mario is now able to learn and feel in the confines of his 8-bit universe.
Visit a couple of museums from all over the world in a single day. The world’s most famous paintings are just one click away.
Do you think you are made from bits and bytes? Stop playing video games and spend some more time offline! Both atoms and bits are basic parts of matter.
Will handwriting soon be history? Or will we always prefer a handwritten love letter from our beloved?
The Archéologies des Medias exposition turns archaic technology that was once cutting-edge into art.
Emily Howell is an interactive interface able to compose and perform her own pieces of music.
Created by Vik Muniz and Tal Danino, Flowers uses livers cells treated with smallpox vaccine in order to create floral patterns.
If we are going to mutate the made & the born, let us at least do this creatively.
These robotic ants by Festo are learning to work together, like real ants do.
Designer Behnaz Farahi envisions an interactive 3D printed outfit that can detect and respond to the gaze of the other and respond accordingly with life-like behavior.
This image, generated by a computer, portrays a representation of what seems to be some kind of squirrel-meets-sea-lion-meets-slug-type of creature.
iSkin is a flexible, stretchable and visually customizable on-body touch sensor for mobile computing.
Beetles, dragonflies, butterflies and bugs made from recycled deconstructed computers, smartphones and consoles.
Encyclopedias and maps use fake entries and locations to protect their works.
The current technology has not been able to replicate Christ the Redeemer perfectly, until now.
The Green Brain Project aims to create drones that will think, act and sense like a bee.
City of Drones puts you in a first person view of a drone drifting through an abstract futuristic cityscape.
From August 1 till 16 2015, Next Nature Network’s art director Hendrik-Jan Grievink will be co-tutor of the GDA Summer Sessions.
Our constant need of new, cleaner energy led a Michigan State University research group to conceive a fully transparent solar panel that could replace ordinary windows.
A wooden floor that follows the curves of the tree it's made of, thanks to smart milling techniques.
Project Jacquard makes it possible to weave touch and gesture interactivity into any textile.
Two American hackers have been working on hacking cars to takeover full control of vehicles.
Easy-to-assemble customized tiny houses that can be covered under layers of soil, turf, or even sand and snow.
How would you feel if robots inherited ethical complications of existence?
"However, while 3D printers are becoming increasingly accessible and capable of rivalling the quality of professional equipment, they are still inherently limited by a small print …
Japanese fashion brand Buyma created this video with a wink, wherein drones play a crucial role.
Pembient, a West Coast startup, might have a solution to the rhino-poaching problem with its lab-grown rhino horn project.
A visit to a massive, secretive Bitcoin mine that is said to make 800.000 Euro per month.
The popular car brand is working on augmented reality goggles that enhance the driving experience.
The tour of our lustrous NANO Supermarket is coming to Riga, Latvia.
A team of researchers recently developed a new method for 3D printing that can reduce the printing process down to minutes.
An extraordinary yogurt that could soon implement accurate, young disease diagnosis.
Dom Indoors , is the latest research project developed by a construction robotics company called Asmbld . It includes a robotic system that can reconfigure an indoor space within …
Scientists at Harvard University inserted wooly mammoth DNA into the genome of the Asian elephant.
The National University of Singapore released a group of robot swans in the Pandan Reservoir to swim around and keep an eye on water quality.
By burning fossil fuels we are responsible for the increase of carbon dioxide in the Earth's atmosphere. Aside from raising temperatures globally, this is also affecting our …
A new seaweed that tastes like bacon and is better for you than kale.
Humans cannot have intercourse with cars or replicate with them, so why would we find cars sexy anyhow?
A 3D printed helmet able to translate brain activity into the movements of its shape-changing structure.
Solar Impulse 2 is a Swiss project with the aim to enable long term flights using solar power.
A tree, made with 3D printed leaves that contain solar cells.
In this era we are reaching for the sky. But back in the 17th century however, something different was happening in Sweden.
Gavin Munro is creating a farm where planted trees can be grown around braces and harvested as fully formed chairs, sculptures, lamps, and tables.
The first ever circus consisting entirely of drones is coming to Amsterdam. This fall the Amsterdam Arena will host a choreographed airshow using nothing but drones combined with …
What are then the actions to foster for an effective sustainability? A series of articles will try to point the plastic poblem.
The U.S. Secret Service is conducting test drone flights over Washington, D.C.
If you experience virtual reality sickness, here some solutions for you.
This Is What $15.3 Trillion of World Trade Looks Like.
The Wearable Tomato Project consists in a robot that dispenses tomatoes.
The entire continent of Australia has shifted and that's a problem for GPS, meteorologists, automated cars and even drones.
The first self “driving” boat will be entering the canals of Amsterdam in 2017 with versatile ends.
The first beauty contest judged by complex algorithms has sparked controversy after biased results.
What happens when our dreams become a commodity and advertisers gain the technology to enter our dreams?
Our peculiar image of the week comes from the Great Barrier Reef. You've probably seen images of this vibrant underwater attraction before. If you're lucky, maybe you've seen it …
team of computer scientists at the universities of Germany and California has created what they call photoshoping videos in real time.
By 2050 plastic waste will outnumber the number of fish in the sea. These Surfers are taking action and raising awareness.
At Hyowon Healing Centre in Seoul you can experience the emotional cost of a suicide during "Death School" classes.
Designer and architect Neri Oxman explores how digital fabrication technologies can interact with the biological world. Watch the TED talk.
If you compare the supermarket banana with the original wild banana the differences in size, look and taste are striking.
Researchers are creating accurate 3D models of living organisms to preserve the heritage of life on Earth.
This village is powered by building-integrated solar panels and provides shelter for 350 people, putting sunlight to better use.
It’s true that mexicans celebrate Day of the Dead dressing as skeletons and setting shrines to death, but the carnivalesque parade with giant puppets was a surprise to every local who watched the movie.
This Instagram model makes her fans wondering whether she is fake or real.
As part of a new traffic safety initiative, a car manufacturer, a telecommunications operator, and a coffee chain have joined forces to develop a new app designed to promote safer driving.
Chloé Rutzerveld presents a modern version of the iconic stroopwafel, fully made of vegetables.
For years scientist and farmers are researching the possibilities of eating duckweed, shoveling it out of the ditches onto our plates. This proteinrich plants can be used in animal fodders or be eaten by humans.
The 5th largest airline in the United States, JetBlue, is growing potatoes at John F. Kennedy Airport in New York.
Paris passed a new law that not only allows locals to plant their own urban garden around the city, but also encourages them in doing so.
Anton Repponen's project places iconic NY buildings in organic, untouched environments to put them in the spotlight.
Japan is the first country to accept the bitcoins as payment method for basic services.
A floating photovoltaic system will lie on the waters of a Japanese dam, representing the largest solar establishment in the world.
From October 11 to June 11 we will discuss the future of meat at Cube Deign Museum in Kerkrade (The Netherlands) with the exhibition Meat the Future.
Using biology as a model for innovation and progress, Alyssa Stark embodies the essence of Biomimicry.
The Farmer Drone is a hardworking drone that ploughs land, grows crops and milks the cows, all on the same day.
The Weather Drone controls the weather, it makes sure the sun will shine on your birthday, or that the rain will fall during a period of drought.
This is the WiFi drone, a useful companion that perfectly blend into our environment while providing us with information and connectivity.
In the port of Rotterdam you might be able to cross a floating Waste Shark: a robot able to collect up to 500 kilos of trash.
Feeling as if the world comes to a hold during a blackout.
Our workshop with kids from Lanterna Magica, an unconventional primary school in Amsterdam.
An ecofriendly alternative to plastic lies on the surface of waste streams.
We recently stumbled upon a rare mutation: the non-disposable disposable razor.
Disney's Frozen is causing tourism overload in Norway, and it's not sure if that is a good thing.
What if we can no longer rely on authenticity of voice recordings? A demo software to alter them premiered recently.
UV Production House reflects on popular online platforms for maker culture.
Designer Wataru Kobayashi created a picnic cutlery set to promote eating insects.
What happens when someone places a virtual property on top of a physical one?
A team of scientists has developed a way to deliver drugs into our body using nanobots as vehicles and our toughts as controllers.
Instant ramen noodles have become a valuable commodity to inmates, as cost-cutting measures in US prisons led to the deterioration of food quality.
At a lab in Berkeley, California, there’s a mouse with no legs. Its head, torso, and tail are normal. It just lacks limbs. It didn’t lose those limbs; it just never grew them originally.
Watch this robot solving the Rubik's Cube in 1.047 second.
By way of reverse engineering and taking heart cells from a rat, researchers at Harvard University have designed a miniature robotic stingray that is alive.
With winter just around the corner, salt trucks are getting ready to hit the road spreading tons of salt. Ice free asphalt is necessary to drive safely and keep transports …
E.O. Wilson, a respected biologist, has proposed a radical idea: set aside half of the planet as nature preserves.
Turkish shepherds are installing solar panels on their donkeys to stay connected.
Jill Watson has been performing as teaching assistant for 5 months, but she is not a real person, and students didn't notice.
Case IH debuted their autonomous farm tractor that plants, monitors crops and harvests, all without a driver.
Last week the Olympic women’s diving pool at the Maria Lenk Aquatics Centre mysteriously turned swampy green overnight.
Samsung just revealed the prototype version of Bedtime VR Stories, a technology that connects parents to their children in virtual reality, right before bedtime.
IBM's Watson succeeded in creating its first-ever movie trailer for the upcoming sci-fi thriller Morgan.
Sweden's new Icehotel 365 uses solar cooling to stay open all year.
The world's first 3D printed office building opens its doors in Dubai, paving the way for the building of the future.
Japanese architect Kazuyo Sejima is designing the world's first invisible train.
In 1996, Yoshinori Kuwabara at Juntendo University in Tokyo incubated a premature goat fetus by using extrauterine fetal incubation.
Meet the commercial 3D pizza printer that takes your order via a smartphone app.
An AI draws streets and spaces stitching together its artificial memories of real places.
Global data about animal movements are indispensable in our today international networked world to understand how to safe human health and wildlife simultaneously.
A study revealed that the sound of motorboat engines disturbs coral reef fish so acutely it changes their behavior, making them bad parents.
American company Ideo has taken the essence of on-demand economy at heart, presenting a vehicle with detail-designed services for the future of carpooling.
A series of photographs from the Ciptagelar village in West Java, Indonesia.
Tons of living animals have floated from Japan to the United States traveling across the ocean on plastic junk and debris.
What if you had the choice of sparing your child from diseases and disorders such as Alzheimer’s disease, heart disease or autism?
ECO coin has been selected as on of the top 30 ideas in the ASN Bank World Prize for its innovation, feasibility and impact.
Scientists developed a device that converts polluted air into clean air while generating power.
Virtual reality experiment tries to help people frightened of death with outer-body experience.
Google cars can now measure urban air quality and collect data to create interactive maps with the most detailed views of pollution patterns ever created.
Researchers from Arizona and NASA unveiled a plan to sustainably provide food in space, growing it in an inflatable greenhouse.
Researches at the University of Illinois released a step by step guide to build 3D printed bio robots with living muscles.
A job from HUBOT: as an exoskeleton mover, you wear a motorized exoskeleton suit that gives you the muscular power of a gorilla.
A visual impairment does not have to be confining and futile when it comes to traffic control. As a blind traffic regulator, you wear a haptic suit that translates the traffic …
As a data waiter you are working at the Tinder restaurant. Upon arrival, visitors log in with their social media account. An intelligent algorithm matches the guests based on …
When giving first aid, all kinds of emotions are in play. Thus it is important for the victim of an accident to receive emotional assistance and to be mentally supported during an …
What can we learn from listening to the buzz of bees' conversation? With the help of a new monitoring system, a Canadian researcher is hoping to find out.
What if you could upload your fondest memories to the cloud? Watch episode 4 of our Intimate Technology video series.
The body, like any technology, is made up of countless individual components. Yet, apart from dire medical emergency, have you ever thought about mixing and matching these …
The last episode of our Intimate Technology series follows a minute in the life of a hyperconnected family in the digital era.
Volvo's driverless car system has trouble recognizing kangaroos because it gets confused by the hopping of the marsupial.
Sen is a space television network that provides visuals from other planets in order to prepare us for our multi-planetary life.
Nomophobia, no-mobile-phobia, is the fear of being separated from your smartphone.
With the rise of modernity, we have domesticated ourselves with new technology: discover how the world spends one minute on the Internet.
This group of 14 designers, engineers, builders and architects make a proposal of a wall for Trump's ambitious project.
The Tappy 'smart ring' is a wedding ring connected to your bank account.
The Pink Chicken Project suggests modifying chickens’ DNA in order to send a message about our Earth health.
Antonio Esparza designed the TurtleBag: a 3D printable exoskeleton to help turtles distinguish plastic bags from jellyfish and extend their lifespan.
We published a timeline series to explore medical, cultural and technological developments in relation to the ectogenesis concept.
After mounting criticism from environmentalists, a firefly-themed park in China announced that the glowing bugs will be replaced by lasers.
Open-air tests of self-destructing moths mark a new frontier for GMOs.
Rooftop farm takes over Israel’s oldest mall to grow thousands of organic vegetables.
You did not make it to the Idols final, but you can sing very well and you love to make people happy. As a singing package deliverer, you deliver packages with a personal song. …
What if we rethink the system and instead of building from earth to sky, we do it the other way around?
A study shows that screen time for kids between six months and two years triggers expressive speech delay.
The story of money: an accessible roadmap from prehistory to digital age, from cows to credit, from gold mining to bitcoin mining. This episode: shells.
A Facebook chatbot that offers interactive cognitive behavioral therapy. It’s called Woebot and it's your personal virtual counselor.
A recently discovered plastic eating worm could be used to safely digest our massive plastic waste.
A wind farm in Scotland is on hold because of its lethal killing power towards seabirds.
Calling all bloggers! We’d love to have you on board for the 2018 Border Sessions festival in The Hague (NL). Join our team for behind-the-scenes access to festival events. To …
Today, artificial intelligence is doing all kinds of things: It can write an episode of game of thrones , it may revolutionize the teaching industry , and it's drawing new streets …
As a cybercrime detective, you search for suspicious patterns that indicate crime in the digital domain.
While many people consider a rollator as a sign of decay, you as a rollator inspector are just part of the headway! The walker inspector measures air quality, particulate matter …
If you are in The Netherlands you can explore the latest art project by Studio Roosegaarde and discover the iconic, yet historical value of the Closing Dike.
Not only does this phone case conceal your engagement ring in preparation for the big moment, but it’ll then take a video of your partner as you go down on one knee.
Rayfish Footwear was a fictional company that offered personalized sneakers crafted from genetically modified stingray leather. This online science fiction story allowed customers …
Well, we finally made it. After a long, cold, dark winter, spring has officially started today. And guess what it's bringing with it? Nope, not spring flowers: Love flowers! …
The South Beach diet. The Atkins diet. Eating paleo. Cutting out gluten. Going vegan. The list of fad diets and health crazes goes on, yet health statistics in the US and around …
Arches National Park, located in Utah, is home to some of America's most beautiful rock formations. The most famous of them, Delicate Arch, has always been, well, pretty delicate. So much so that back in the 1940s, park rangers hatched a plan to preserve the natural monument - by coating it in plastic.
Should men be able to give birth to children? Should we externalize pregnancy with artificial wombs? And are these feminist dreams or frankenstein nightmares? Welcome to …
Do you know that feeling when you add someone on your social media and you cannot help to think that, now that this person sees your profile, your posting will never be the same? …
Imagine, it’s 2050 and you are feeling hungry. What will be on your plate? Where will your food come from, and how will it be produced? It may be juicy ants from the nearest …
Look around you and try to find the most natural thing in the room you are in now. It is you. But for how long? Welcome to the wonderful world of bio design ; a world full of …
This question is an excerpt from the Pyramid of Technology toolkit Take a mundane object from your house. Now ask yourself: How will this particular technology enchant me? …
Solar cells are often considered an eyesore, used for their sustainability yet not for their beauty. Installed on roofs or in solar parks, they take up precious space. Well that’s …
Delve into the science and fiction of robots at V&A Dundee’s latest exhibition: Hello, Robot . Contemplate the existence of robots and how they have both shaped, and been …
To our Chinese friends (and beyond)! From 2 November 2019 to 1 February 2020, we'll be crossing the globe for a large showcase at the OCT Art and Design Gallery in Shenzhen, …
We are proud to invite you to our largest showcase (so far), currently on display at OCT Art & Design in Shenzhen, China. Spanning across three floors, with a total surface of …
Our In Vitro Meat Cookbook has inspired many people around the world. Just recently, we had the BBC over at our headquarters to see what makes us thick. This idea of in vitro meat …
We are a network of makers, thinkers, educators and supporters. With members in 44 countries, we are the international network for anyone interested in the debate on our future – …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Each year we search the globe for people and projects that have outstandingly contributed to make this planet a more sustainable place and honour them with our ECO Coin Award . We …
Each year we search the globe for people and projects that have outstandingly contributed to make this planet a more sustainable place and honor them with our ECO Coin Award . We …
Dinner for two, please! Well we didn't expect to say that in a while. Luckily our friends at Mediamatic are working on an innovative solution. Their 'Serres Séparées' dinner dates …
Since the 16th of March 2020, the government of the Netherlands applied new measures to stop the spread of the novel coronavirus (COVID-19). Schools, cafes, restaurants and sport …
Imagine you are single and you finally meet that someone you like. You are in the early stages of dating, but then a virus appears and compromises everything. For some of us this …
During these challenging times, we have tried to find happy moments together where we could find them. From weekly Zoom lunches to having online wine tastings, still, it doesn't …
Meet Jenny Kleeman , journalist and documentary-maker. Sex Robots & Vegan Meat is her first book for anyone interested in, well, sex robots, vegan meat, out of body birth bags …
"Absence makes the heart grow fonder" is a common phrase people associate with romance that has been forced apart by distance. But for long-distance couples (as many of us can …
At first glance, the premise of the film 'The Iron Giant' (1999) seems to be a total failure. An animation film set in the United States in 1957; while the Russian satellite …
At the bottom of the Earth’s oceans lies an intricate network of over a million kilometres of fibre optic cables. These cables were laid on the seabed by telecommunication …
The exhibition "Apocalypse - End Without End" shows that the end is a human invention
Promising food design projects do not always find their way to producers, the market and ultimately to consumers. Why is that and what can we do to advance these ideas? Why is it …
Phytoplankton are microscopic algae living throughout the ocean’s surface waters. They can’t swim and are at the mercy of the currents and tides. Despite their small size, …
In an era of high-tech and climate extremes, we are drowning in information while starving for wisdom. Architect Julia Watson imagines a design movement building on indigenous …
Here are 5 things you cannot miss at Floriade Expo 2022
The ‘Beneath the Surface’ exhibition organized by Taiwan Designers’ Web at the Chiayi Art Museum teaches us about unconventional connections, past and future.
Using the waste streams from the chemical industry and urine to make biocement.
Each year we search the globe for people and projects that have outstandingly contributed to make this planet a more sustainable place and honour them with our ECO Coin …
Exploring the co-evolution of yeast and humans, while discovering the aesthetic value of yeast biotechnology, is what designers Anna Dumitriu and Alex May have been concocting. …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
The most wonderful time of the year can turn stressful quite easily when you run out of exciting gift-ideas. Don't worry, we got you covered.
Most radiation is natural and life on Earth wouldn’t be possible without it.
We are now so used to communicating with some robotic device in our homes. But this skill cost Furbies a national ban in the US.
Musicians have stumbled upon an unconventional and intriguing creative partner: plants. Yes, that's right, plants. Through the use of advanced sensors and software, …
In 1912, the RMS Titanic met a fateful demise as it crashed into the depths of the North Atlantic Ocean, leaving a mark on the world's collective memory, and igniting a lasting …
In the evolving scenery of self-driving taxis in San Francisco, passengers are getting frisky in the backseat of driverless taxis.
A floating sustainable city where humans can live, work and study while supporting aquatic ecosystems. Soon this will become a reality in Dubai, as sustainable real estate company …
There is a banana crisis happening right now. Our beloved yellow fruits are being threatened with extinction due to a fungal infection called Panama disease, which can wipe out …
As the world is trying to keep carbon emissions under control, humans are also looking for viable carbon-neutral transportation options. The people from French rolling stock …
Within the digital realms of our smartphones, WhatsApp groups cater to diverse intents: exchanging witty dad jokes, soliciting style counsel ahead of night-outs with friends, or …
In the 1970s, NASA and the ASI launched a giant disco ball into space. Its purpose? Teaching the humans of today and the civilizations of tomorrow about Earth.
Thanks to the European Space Agency (ESA) and a team of enthusiastic researchers from the University of Thessaloniki we now know for certain: we can fry potatoes in space. …
What if we could clean our water with magnets? Wageningen University & Research, introduces the Magnetic Adsorption-Desorption (MAD) project.
Computational Biologist Jing-Dong (Jackie) Han and her team uncovered a technology to interpret signs of biological aging directly from facial characteristics.
As the year is coming to a close, many of us are preparing our homes and dinner tables for a festive meal.
Sushi designed in Japan, printed in Texas. This might sound like a wild dream, but actually became a reality during interactive media festival South by Southwest (SXSW) that took …
Technology can help us to connect with our surroundings. Think about the microscope: it revealed ecosystems beyond our visual reach allowing us to look at the smallest inhabitants …
I know, this is a nice piece of fantasy rather than Next Natureâ„¢, but still, you gotta love it. Directed by Jan Urbanowski and Jethro Haynes, animation by www.wer3d.com. Check …
SINGAPORE (Reuters) Some people like to talk to their plants. Now, students at Singapore Polytechnic say they have created a plant that can communicate with people - by glowing …
In the early days of digitalization many metaphors from the physical world were translated to the digital world; think desktop folders, trashcan and shopping cart. Now we have …
Instruction for the Birds: Land on perch->trigger sound file->observe human response-->behave accordingly. Instructions for People: Listen, you'll be able to understand. The sound …
NEC corporation is developping a "Childcare Robot PaPeRo" capable to play with and watch over children. The Childcare Robot is capable of recognizing and verbally communicating …
Hope you have a strong stomach for this one: There are many ways known for decorating the body (both human and f.e. swine ). But it's fascinating to see that so many "cutters" …
"In the morning paper, I can read the weather report as well as the stock quotes. But when I look out of my window I only get a weather update and no stock exchange info. Could …
The new Bob Ross has arrived: his name be Gautam Rao. This painting shows a magnified part of the dock in OSX. I especially wanted to highlight the Picassoesque face on the Mac …
Gummed tape with a fruit-like print on its surface. The tape reminds us of the feeling of peeling fruit when opening a box. A design for opening, rather than packaging. Designed …
News at Seven is a set of preferences for what a newsreport should be about. Using keywords entered by the user, the program selects news site RSS feeds and specific stories to …
Google has added it's first map of a Solar Planet to the google maps. The map of Mars provides detailed information of its mountains, craters, plaines and more (including …
GPS drawings over land , on water , and in the air were created to investigate principles and techniques of geodesic drawing. The maps were made to measure travels and tracks and …
Electricity itself is a natural phenomena, but as regular AC/DC currency it becomes a commoddity. But Green Electricity is a strange thing. You pay more money for your electricity …
Remember the beautiful sequoiaview harddisk visualisation posted a while ago? Above a more illustrative harddisk tree visualisation by professor Jack van Wijk. Branches are …
Consider an Orangina bottle: shaped like an orange it is designed to look like one. But it does so in a very primitive way. Imagine the product is the packaging. Wouldn't it be …
Toasted bread as an information display device (originally developed in 2001 but somehow still intruiging): a toaster that parses meteorological information from the web and then …
Thanks to this device our pda's may become even smaller. Also piano's and dance clubs are made redundant. All you need is a charged battery. virtualdevices.net
Klima Kontrolle (video) is a project by Roel Wouters and Luna Maurer . A fan is placed in front of a computer screen and accelerates until it blows away the entire desktop. …
Tringo is an online multiplayer game created by Nathan Keir (aka Kermitt Quirk) in December 2004 that runs inside the virtual reality platform Second Life. It is described as a …
Metalosis Maligna is a documentary by Floris Kaayk about a disease which affects patients with medical implants. Sourcing from such implants a wild metal growth ultimately …
There may even come a moment that our connection with an industrially manufactured coke bottle may be richer and more mythical that our relation with a genetically analysed and …
During the upcoming Amsterdam Museumnight, the Institute for Timebased Arts (Montevideo) will be hosting a show called Natural Habitat, in which artists play with the borders …
Lecture spoken by Henk Oosterling at Biggest Visual Powershow , Zollverein Essen, Germany, 23 June 2006 Damen und Herrn, Next Nature, Nächste Natur ist ein Pleonasmus, ein …
Photojournalist Robbie Cooper captured images of gamers and their real-life selves. Here are their stories. Bae plays a man because she thinks that male avatars have more …
The machine and the experience of the machine are becoming one. I've seen these kind of things in computer games, but now they are becoming real— Feels like plugging in to the …
pollution + streaming = pollstream; an intervention in environmental ethics. It creates a series of interactive environments in which members of the audience are in a process of …
Jos de Mul (Erasmus University Rotterdam), published in Next Nature Paperback, 2005 For someone whose main instrument is a computer, the world becomes a gigantic database. We see …
The Sababa is the first real time lava visualiser kit of global city flows. It takes the lava lamp one step further by reconstructing it according to the language of the current …
A critical and visual take on culturally emerged Nature. Full of statements from designers and thinkers from around the globe. Wild systems, Genetic Surprises, Calm Technology, …
The flower depicted in the image is a good example of Hypernature. While fake nature is always a flatter surrogate of old nature, hypernature is a simulation of an old nature that …
Is it possible to let a first sketch become an object, to design directly onto space? This is a question that Front Design have just asked in their project Sketch Furniture. "The …
Ok, so it is a bit corny. But since there is an amazing hypernatural supermouse starring in this video (quicktime) , we had to post it. Created by Nieto Luis. Thanks Jan.
A short story by Terry Bisson. For those who prefer video to literature, there's also this seven-minute film adaptation . "They're made out of meat." "Meat?" "Meat. They're made …
Another gadget. An usb memory stick that is capable of changing its physical size, depending on the amount of data it holds. when the device is about to blow up one can see the …
Don't let the sun have the monopoly on making people love you more. Get the USB Desktop Tanning center and, in the comfort of your own cubicle, a scrumptiously golden tone can be …
In the not-so-distant future people will be given a pig with their own DNA engineered into it. The pig, known as a "knockout" pig in the scientific jargon, is a form of living …
A traditional textile heritage is celebrated with flocked wallpaper that comes to life as it reacts to ambient noise levels. The louder the space the brighter the wallpaper glows. …
An umbrella that provides information about the likelihood of rain so that users can make a simple, informed decision about whether to take the umbrella with them as they leave …
Epic is a fictional prospect (from 2004) on the future culture of media and internet-corporations. The human addiction to news and information must - according to this video - …
You have the impression that the disasters of the world do not touch you anymore? You feel vaguely sorry for other people's misfortunes but you don't feel the inner urge which …
Mandy Meißner's "Wildgruen", a plant that can move and communicate. In her view, plants need to be freed from their isolation, both in the way that they can only lean towards the …
Just read this article on Darpa 's work on using bugs for war effort . They are planning to make a kind of insect cyborg to use in the army. The Defense Advanced Research Projects …
The Norwegian government will hollow out a cave on the ice-bound island of Spitsbergen to hold a seed bank. This seed vault is an answer to a call from the international community …
Paraisópolis favela (Paradise City), Sao Paulo Huge slums, located on prime real estate, calmly being closed in by money (at least in the shape of concrete towers). Dharavi, …
Let us pretend you are a soldier and you are being sent to war. One of the first questions that should pop into mind: how will you prevent yourself from getting shot? Armor that …
Behold the Apple Desk , created for all those Apple IPod style victims. Moreover this design is a wonderful illustration of the penetration of computing in everyday life; once the …
Genetically modified plants may be the green solution for cleaning up polluted sites . Researchers David Salt and John Freeman aim to develop plants that remove toxic metals from …
Augmented Fish Reality is an interactive installation of five rolling robotic fish-bowl sculptures. These sculptures allow Siamese Fighting fish (Betta Splendons) to use …
Barcode tatoos . An intuitive manifestation of the decreasing border between humans and products?
At the Biggest Visual Power Show 2006 , held in Zollverein, Germany, over twenty artists, designers, filmmakers and philosophers gave their view on Next Nature. Click to watch the …
Joris Laarman 's Bone chair takes its inspiration from the efficient way that bones grow (adding material where strength is needed and taking away material where it's …
Where other trees grow their branches towards the light, willows seem to want to touch the surface. Tim Knowles creates drawings independent of his own hand and when he attaches …
Using electrodes positioned around a person's scalp, scientists from the Centre for Research and Technology Hellas in Greece are developping a method for electronic identification …
Donna Conlon is a Panama-based artist who often uses the relation between man and environment in her work. In her short film "Coexist" we get a close-up look at leaf cutter ants …
This weeks peculiar image was taken this summer by a friend of mine. He went to a birdmarket in Esfahan, Iran and noticed that discrimination takes many forms; only blond chicks …
Starting as noise makers, the owlproject work on different products which are deeply rooted in nature. And electronics.With their logs the owlproject travel around the world, …
The lasertag , made by Graffiti Research Lab , allows people to leave their mark on the city for a short while, without getting your hands dirty. After Rotterdam, New York, …
The TEMPO is a fake product with a real idea. As I am really neat and eager to clean up my digital desk I tend to throw away too much files. This digital trashcan copies the stuff …
Inventors keep coming up with new ways to exploit RFID (Radio Frequency Identification) tags. Now Kodak wants to use them to probe a person's digestive system. RFID tags are tiny …
The EnergyTree is a device dedicated to monitoring your household energy use. It monitors you energy output from sockets and any device that is using electricity. It also monitors …
I have been conducting some attempts to backtrack the evolution of Gillette shaving razors appearing in my bathroom. Whereas older shavers were simple sticks with a blade on top, …
At the beginning of the digital era, several metaphors from the physical world were transferred to the digital environment in order to make, otherwise incomprehensible, technology …
Cartoon characters fuel our imagination. For the duration of the book or movie, they supply us with an alternative playful identity; an escape from the dull monotonous everyday …
It's fascinating how stock traders can get so excited about a few abstract numbers on an electronic display. These numbers represent real money, and every small fluctuation can …
Did you ever wonder why the letters on the keyboard are in the order they are? The reason for QWERTY goes way back. This order was chosen to reduce the probability that mechanical …
Which of these women do you think is more beautiful? At the 2002 Miss Germany pageant, the eight finalists were photographed from the same angle without makeup. The portraits were …
After cooking lobsters alive, picking your own living fish in a restaurant and serving your rabbit for Christmas dinner, now comes a wonderful new creation: the FishBoil. This …
Here's an animal-friendly alternative for Tinkebells Cat Bag and it scares the crap out of mice! There's also an instant infant and a cuddly fish bowl . These cardboard-pets were …
A Nike shoe stapled together with human flesh, created by Adam Brandejs .
Food is no food. Food is scent. Food is temporary experience. Food is message. Welcome to this magical gastronomy tour. You will enjoy the tasty (video)links below: Works by Chef …
The bear is a wild animal, a predator and hostile to man. Yet somewhere in the beginning of the 20th century someone caught the idea of making a cuddly toy out of it. Perhaps …
Al Gore would love one of these mugs; displaying what happens when the world heats up and oceans begin to rise. Via Shikake | See also: ScaryIdeas.com | Related posts: Design A …
Haptic technology refers to technology which interfaces the user via the sense of touch by applying forces, vibrations and/or motions to the user (Just think of the Wii ). At the …
What to do about the shortage of human organ donors? An emerging branch of medicine, called organ printing (future vision alert) , takes a patient's own healthy cells and uses a …
If you're longing for the touch of a loved one who is a few thousand miles away, what better way than to pick up the Hug Shirt for the both of you? This shirt is capable of …
With this cooking timer gadget , you can explain information decoration to anyone. In addition to its default explicit digital time display, it has a modus in which the passing of …
A bug that does the cleaning? This 1-meter (39-inch) tall, 1.35-meter (53-inch) long prototype robot ' named "Lady Bird" ' is designed to clean public restrooms at highway rest …
What did you play with when you were 8+ years old? Well let's say some people can never quit playing. The Bjarke Ingels Group ( BIG , Copenhagen-based group of 85 architects, …
For centuries artists painted trees and clouds because that is what they saw around them, nowadays they remix brands and logo's because that is what surrounds them. A city child …
There's a long line of cars And they're trying to get through There's no single explanation There's no central destination But this long line of cars Is trying to get through And …
Utopian Suburbia? More amazing aerial pictures at imagenesaereasdemexico.com .
Just in case you hadn't seen this one . Informational spaces define physical spaces, rather than the other way around. The map is the territory? Let's just hope the territory can …
NAT, designing nature is about the interface where nature and culture, biology and design intertwine. An exhibition that is a cross between an exotic Garden of Eden and an illegal …
It is true, they are rare, but they do exist: girls with tiny waists and large breasts. Occasionally, women are simply born like this. The only problem they have - in a world …
Products by 100%... to make the light in your house/office feel more natural. 100per.com
It was in the news all over the world, but wonder why at NextNature.net we have not mentioned the 'invention' of the transparent frog before? Probably because we think the frog is …
"Not A Cornfield" is a project (2005) by Artist Lauren Bon. It's a living sculpture in the form of a field of corn east of Downtown Los Angeles. The site - historically a train …
No, these aren't X-ray pictures, these are designers bags! Part of the Observe/me fashion line of bags, wallets, gloves and coats created for the modern observed people. …
It looks like spiders are learning from the web and use peer-to-peer technology to build their web: "Entomologists are debating the origin and rarity of a sprawling spider web …
Packet Garden is an experimental artwork that seeks to provide an alternative and accessible approach to visualizing daily internet use. Plants are also grown for each protocol …
Aquarium screensavers must be as old as the first RGB-monitors, but in times of fast and turbulent software development, the underwater world proves to be a familiar and relaxing …
Artist Nicola Costantino creates objects that comment on the meat and leather industries. In the surrealist tratdition, these handbags and shoes are imprinted with tiny images of …
You put all that care into your plants, and what do you get in return? Magic. Buy a can with a bean seed , add water, watch it sprout with a message etched on the leaf. Well in …
Ever since Rosie from 'The Jetsons,' robots have been the next big thing, but the business case was never there. So far, companion robots have been a big flop in the market , but …
We are all born in a world that has been designed already. Cars, dishwashers, dildo's, remote controls, ATM machines. Although these products are supposed to make life better, …
Comedian Paul Merton went to China for Five.tv (early 2007) and near Beijing he reads the following headline: This farmer grows robots...
"Every year, in Germany alone, around 7000 people wait for a new cornea to save their eyesight. But donor corneas are in short supply. In an EU project, researchers have developed …
When he's not saving the word, artist Matt Siber is disecting street images and their typography. Seen before in many forms on this blog, but very well done!
Anyone can explain Baudrillard with this move. After the recent passing-away of this philosopher, it seems appropriate to post this movie as an ultimate "Simulacra for Dummies". …
I first saw this statement on the Artvertising building . Let this be our slogan of the week.
I don't know how it is with you, but to me sending smileys in emails or text messages always feels a bit primitive. It's not that I don't like the icons, I really do. I just don't …
Lets face it: we spoiled western people are pretty much imprisoned by our self created safe environments and remotely disconnected from the wonders and chaotic surprises of old …
Peculiar object of the week is this square watermelon, found in Japan. Very practical and cost efficient when you want to pile them in boxes and ship them. Artist Piet Mondrian …
15.000 Years ago we lived in caves, wore animal-fur and ate mammut- noodles !? Oh well, though our knowledge has grown a bit, the human nature hasn't changed that much: every …
Myoung Ho Lee, a young artist from South Korea, has produced an elaborate series of photographs that pose some unusual questions about representation, reality, art, environment …
The MQ-9 Reaper is loaded, but there's no one on board. Its pilot, as it bombs targets in Iraq and Afghanistan, will sit at a video console 7,000 miles away in Nevada. Although …
After setting up the biggest online voting poll ever for electing seven new wonders of the world, the swiss-canadian filmmaker Bernard Weber set up a new poll: the election of …
The Objectuals is a series of work by artist Hyung Koo Lee , it features an interesting mix of visual distortion apparatus for the human body. Lee says that he experienced …
Genetic engineering isn't just for scientists in ivory towers or corporate R&D labs anymore. Researchers are still creating new mice and crops every week, but the tools and …
Conceptually the square box and the interior spaces are carved out of an undefined cluster of foam bubbles, symbolizing a condition of nature that is transformed into a condition …
Tickle is a small robot that walks on the human body to generate a pleasant, tickling sensation.It has two motors and rubber feet for a good grip on the skin. When it encounters a …
March 2007 gave birth to Knut, the übercute baby icebear in the Berlin Zoo. A unique event, since it was 30 years ago a baby icebear was born in the zoo. Within weeks, Knut has …
A proposal to gain 600.000 m 2 of land near the Dutch coast recently came from the CDA (Dutch Christian-Democratic political party). The idea is to create a tulip-shaped island …
Victoria has great realism, perfect imperfections, and incredible ease of use. Based on live human models she is trying to close the gap between real life and models typically …
Atkin's Architecture Group recently won the first prize award for an international design competition with this hyperreal entry. Set in a spectacular water filled quarry in …
"Who wants a stylus?" Words by Apple's Steve Jobs when introducing the iPhone that uses a revolutionary input device: the finger. Using this device you find that it's pretty hard …
Yes, I understand the media interest in Second Hype (Of course we don't take it serious as a virtual reality concept. Steering a mouse, sitting behind a flat screen, moving 3D …
Since we don't need to be able to move our heads anymore these days we might as well use the unused space between our head and our shoulders. That's what designer Francesca …
This installation is called Feed and raises ferns that can survive under conditions of extreme lighting. The television screens provide light to the plants, which grow …
Imagine the impossible… a secret transatlantic tunnel running between New York and London, that has lain undisturbed for a hundred years. And imagine an extraordinary optical …
This summer researchers from technology firm QinetiQ and from Aberystwyth University flew an autonomous unmanned aerial vehicle (UAV) over fields in England and Wales to map the …
While time seems to flow in this one direction, some people just know how to walk straight through that fourth dimension; catch it in a videoclip and throw the message into …
The Ambient Umbrella shows when rain or snow is in the forecast by illuminating its handle. Light patterns intuitively indicate rain, drizzle, snow, or thunderstorms. Local …
Anyone can build the house of their dreams via scaryideas.com The previous images are of course created for commercial purposes, but just take a look at the domestics below and …
A 21-leaf clover discovered on June 3 by Iwate prefecture farmer Shigeo Obara has shattered the Guinness world record for most leaves on a clover stem ( Trifolium repens L. ). The …
Who would not need a bananawall in their officegarden? This modular freestanding, indoor/outdoor bananawall system was designed by Stefan Sagmeister . It is made of 7200 banana's. …
Famous street artist Banksy left his grafitti spraycans at home and sets to opening a pet store. The difference with this pet store is that instead of looking at pets, you look at …
Peculiar image found at: leoburnett.com Barcode zebra via: photochopz.com Barcode bottom via: jetcityorange.com Found another barcoded animal? Please post below. Related: Barcode …
We posted this fella two years ago but the guys at Boston Dynamics haven't been sitting still. Improvements have been made and Big Dog got puppies! Little Dog (a learning robot …
The Biggest Visual Power Show is an intellectual show that blends between a conference and a pop concert. Twenty filmers, scientists, designers, artist and thinkers present …
This landscape is titled 'I can not help the way I feel' and was created by John Isaacs . The way in which the flesh grows, erupts and engulfs the body can be seen as a metaphor …
This burka transmits a self-chosen image of the women wearing it over bluetooth to nearby sellphones. It's a concept by Markus Kison, and it seems like no laws of the Koran are …
Tech company Fuijtsu released a new way to look around you while driving a car. Following the old fashioned neck turning and mirroring this tech has cameras around the vehicle to …
Remember the classical dadaist fountain of Marcel Duchamp – who placed an urinal inside an art gallery and proclaimed it was Art? San Fransisco based artist Clark Sorensen takes …
Popping corn with your handheld? Pity this recently discovered cellphone feature is a hoax , created by a company to promote bluetooth headsets (thanks Teun ).
Who likes clouds anyway? Especially for the people still living in the suburbs of Venray (small town in the Netherlands), artist Helmut Smits made this billboard depicting a clear …
Always dreamed of creating your own clouds? You can now create them... from text. Wordle is a toy for generating 'word clouds' from any text, url or rss stream you provide. The …
Schwan Consumer Brands, a leading frozen pizzas brand, has launched a challenging brand: UGLY. The design embraces the rising trend for natural, honest food and the notion that …
Playing God? – "We are not playing..." After having seen this TED talk by Craig Venter , I came across a cynical yet clarifying comic (etcgroup.org) on his plans to build a new …
The Waterboard is an interactive installation by Mike Burton giving the user a chance to play with water without getting wet. By drawing lines on the whiteboard, the water will …
This weeks peculiar image was made by Elephant Artist Sri Siam at the Lamphang Elephant Camp in Thailand. It is hard to tell whether the elephants actually know what they are …
Two middle class cars molded into one luxurious limousine. Created by Ahmet Ögüt . See also Waves of Asphalt , Interchange , On the Road , Sexy Car .
In 2000 on a Japanese auction site , 20 real live Pokemon Pikachus were offered for 925 million dollars. Roughly translated: We capture each one after your order, so we guarantee …
The White House, seat and symbol of the US government, is built in a Roman style, which was in turn inspired by Greek architecture. At left, we see it applied in the Villa …
Last week, the BBC reported a colony of penguins that had gained the ability to fly (video) . The penguins were reported to fly thousands of miles and spend the winter in the …
Tired of looking out on a grey wall and in dire need of a green touch? Then Föhn le fenêtre has got just what you need. The concept is simple enough: artist Karel Verhoeven offers …
If food and consumption are part of a nations identity, then could warfare be culturally determined as well? The short film that plays with this theme is called Food Fight by …
Famous technologist and futurist Ray Kurzweil states: it's going down by 2029, so be prepared to get digital on entirely new levels. According to Kurzweil, machines will have both …
This Tuesday, search giant Google released an experimental tool that tracks the intensity and movement of the influenza virus across the United States by monitoring the number of …
With their project 'Rules of Six' architects Aranda & Lasch envision an unpredictable, self-generating landscape of interlocking hexagons that could represent rooms, buildings …
A single hail storm can destroy the year's harvest. For over 25 years, this gun has been used by vine and fruit growers in France, Spain, Austria and Belgium for one purpose: …
A commercial by an orthopaedic reconstruction company introducing the next generation of joint replacements: " Highly advanced hips and knees. Engineered to meet the needs of your …
Or you could get an iDog. This electronic animal with musical sensibilities. It sits on your desk and sings along with the music you are playing. Dog haters don't need to worry; …
Contrary to popular belief, global warming is not simply a bad thing: there are winners and losers. While low-lying countries, like Bangladesh, are expected to suffer extensively …
I eat... therefore iHam . ijam.es (by shackleton.es ) | ( Apple has a webapp called iHam... but it's far less interesting) Related: Greener Apple | The Tissue Engineered Meat of …
"Do you know what it really reminds me of? ... Tasty Wheat . Did you ever eat Tasty Wheat ?" – from The Matrix. This is a project by pundo3000.com , in which 100 products were …
Between the launch of Sputnik on 4 October 1957 and 1 January 2008, approximately 4600 launches have placed some 6000 satellites into orbit, of which about 400 are travelling …
Nanotechnology isn't just protecting your food - it's in your food. Scientists are manufacturing nano-sized vitamins that are easier for our bodies to absorb. In the future they …
Ken Ohyama makes Japanese interchanges look like a beautiful forest. How about a picnic? See the whole collection here
A giant, smiling Lego man has been fished out of the sea in the Dutch resort of Zandvoort. Workers at a drinks stall rescued the 2.5-metre tall model. "We saw something bobbing …
Mathieu Lehanneur created a plant-powered indoor filtration system, that pulls in filthy air to be processed through a plant's leaves, roots, and humidity, reintroducing purified …
Lightweeds is a project by Simon Heijdens and currently exhibited at the MoMA - part of the Design and the Elastic Mind exhibition . The organisms - plants, weeds, trees - exist …
Never, 1999. By Nina Saunders Just a random collection of her works: Any day now, 2003 – Woodland trust, 2007 Ever onwards, 2001 Age of Reason, 1995 – Confession, 2005 Sincerely …
A 56-year-old man from the Midwestern US state of Wisconsin has been arrested after shooting his lawn mower in his garden because it would not start. The man was charged by police …
The photo of this 'man made sun' was taken on July, 8, 1956 during a Apache H-bomb test on Eniwetok atoll. In 1963, health concerns about radioactive fallout led to a ban on …
Now there is an interesting biomimicmarketing technique we had not seen before. For their new marketing campaign internet security company Messagelabs worked with digital artist …
A lot of dead books were used to make this piece of tree trunk. By Jacqueline Rush Lee | Related: Modernistic Tree | Modernistic Chair
In the category: Creativity with modernistic tree trunks . Created by the good people of Draw me a sheep , who with this project aim to explore today’s human relationship with …
This is not a 3-D-animation of a fictional creature, but an actual existing animal: the Angora Rabbit.
How real is World of Warcraft? When lines get blurred and people voluntarily throw themselves in a state of digital schizophrenia; current values and norms change in ways …
Animation studios working in the field of architectural practice like Squint/Opera create glimpses of the future that are so beautifully convincing, you sometimes wonder if the …
China's high-speed train from Qinghai to Xizang worried environmentalists well before its launch in July 2006. Concerns increased after a photograph of Tibetan wildlife near a …
Some months ago Iran did a test to show off their missile power which turned out to be quite embarrassing because one out of three did not work. Fortunately, they had a good copy …
Make no mistake. The children of the 80's are the bioengineers of today. ://nextnature.net
The video below is featuring a computer-generated replica of actress Emily O’Brien’s face at high-definition resolution. The Image Metrics process takes a captured video and …
An industrial robot has been given an unusual production task; writing out the full Martin Luther bible "by hand" in a calligraphic style. The robot arm appears to be a fairly …
With its 50 cm wing span and 80 grams of weight, this high tech bird is ready to infiltrate swift surveillance squads next summer. Aerospace engineering students at TU Delft , …
Confused with the pile of remote controls in your house? Now here is an idea: get a robot to control them. Researchers at Toshiba have developed a talking robot, named ApriPoko, …
Just because you're feeling paranoid, doesn't mean the fish aren't actually spying on you. Engineers at the University of Kitakyushu created an underwater survey robot that looks …
The struggle between the born and the made is being fought out in a wardrobe on Saturn. By: 1stavemachine.com | Related: Sixties Last
Chantal Sebire suffers from an extremely rare form of cancer (foto: AFP) Since a few centuries some we tend to consider nature as something to preserve. Hence the international …
"Google has stationed approximately a million computers worldwide to be able to process the 40 billion searches per month. One search request uses as much energy as a low-energy …
Second Skin takes an intimate look at computer gamers whose lives have been transformed by the emerging genre of Massively Multiplayer Online games (MMOs). World of Warcraft, …
We used to wonder where all the stuff in the shops comes from. So now we know. This shopping tree is actually the latest logo of the Dutch shopping center chain V&D . Thanks …
An installment in the series of: " Things I have learned in my life so far ". sagmeister.com These dividing pages for Austrian magazine .copy spell out:"Starting / a / charity / …
This week we are sneak previewing our forthcoming compilation DVD featuring the best of the Biggest Visual Power Shows at the Picnic 08 - E-art event on 24,25,26 September at …
Welsh designer Ross Lovegrove ('Captain Organic') placed several glowing Solar Trees in the streets of Vienna (October 2007). These solar powered streetlights could save cities …
After having build nightclubs, shopping malls and natural resorts, second hype residents have constructed a spaceport in their metaverse. They sure have a lot of different rockets …
I used to hear voices in my head, but now they seem to be coming from the walls – am I back in to the womb? No wait.. it's a wall that reacts to the spectators voice (quicktime) . …
At first I thought this first pregnant man was a hoax, but after I saw it on Oprah I realized it must be 'real'. Well, the pregnant man is actually a former woman who had a sex …
This is Petra. In 2006 she fell in love with a peddle boat designed to look like a swan and has never left its side. In winter, when swans should be flying southwards, the peddle …
In our NextNature event BVPS (May 2008), Kevin Kelly spoke of technology as the 7th kingdom of life : a form of evolution whithout the nasty side–effect of dying (Every object …
"Nature adapts, even to human actions that seem to destroy everything. The amazing power of evolution has given birth to a new species of insect. Their ideal habitats are old …
Usually we don't realize the hours of photoshopping spent on magazine and advertising images before publication. The raw photographic material reveals a lot about the fine craft …
" Eat the View " is a campaign to plant healthy, edible landscapes in high-impact, high visibility places, whether it's the "First Lawn" or the lawn in front of your child's …
Recently, two new inventions have been developed. One, the mosquito-buzzer produces a 5 or 6 KHz buzz, which is (or should be) only audible for people under 25 years old. A …
The Telepresence Frame is a domestic object which utilises the fact that one's bodily functions are digitised in order to create a new form of telepresence. Allowing loved ones to …
Long after Second Life servers have been shutdown, Augmented Reality is a common place . Thanks to our bioengineered eyes, or our electronic contact lenses , and years of data …
Japanese scientists made people drive in circles to find out how traffic jams get born. Related: Human Swarms | Harvesting Traffic Information through GSMs | The things we design …
Beauty and the Geek jeans by Erik de Nijs. The trousers offer a full Querty keyboard layout as well as a mouse, speakers and a little joystick. As he calls it: "Beauty is skin …
No animals were hurt or injured in the production of these vegetarian Nikes. Created by Paul van Barneveld . Thanks Floris . See also Flesh Nike .
Voodoo is an ancient religion, originating from Africa, who’s mystical practice is believed to bring reward to those who are willing to place their destiny in the hands of loving …
Set amid farmland in rural Japan, this small project is a bizarre hybrid of landscape art and infrastructure. It consists of a square, 20-space car park that looks as if it has …
Processed lunch meats etched with a laser cutter. The images show the source of the meat, making you more aware of where that great taste comes from. Link
Videogame players celebrated this week as a hotly anticipated sequel to the popular online video game World of Warcraft hit the shelves. The nine million gamers can now play a …
19th century people needed some explanation to understand the difference between the regular candlelight and the electrically simulated candlelight. Note the disclaimer at the …
The recent discussion on boomeranged metaphors reminded me of this 20 pound mouse hand created a some years ago for a Paradise by the laptop light event on Next Nature. The …
Using thermochromatic ink, which changes color when the temperature exceeds a specific degree, designer Josien Pieters created a prototype of a dynamic wallpaper that …
What if the mannequins in the shopping windows suddenly started moving? Would you buy more, or would it just trigger your anthropomorphobic responses? Soon we will know. Momo is a …
This picture was taken in Zambia by Sarah Los (NL) while on wildlife safari . Every fairly trained "NextNature spotter" should be able to distinguish the cellphone-tree masts from …
This new 3D webcam with two cameras spaced approximately as far apart as human eyes is our anthropomorphic object of the week. Can you feel it, watching you? The little brother …
Venice, Italy is sinking. To save it, Dr. Rachel Armstrong in her TED talk argues we need to outgrow architecture made of inert materials and, well, make architecture that grows …
LOUIS VUITTON AK-47 GUCCI MP-5 Justin Melnick is an avid photographer, digital artist, and has lived in the Middle East. All of these influences have come together in his latest …
Meet A.T.R.E.E.M. (acronym for Automated Tree-Rental for Emission Encaging Machine), a device that compares daily activities, energy and products to the growth of a tree. "From an …
The shrinking size of electronics allows for the implantation of increasingly sophisticated electronic devices in the human body, paving the way for new prosthetics and …
A renewable energy technology company in Australia designed this power generation system inspired by the shape of the tailfins of sharks, tuna and mackerel. The currents on the …
At the start of the digital era, metaphors from everyday life were used – in what was then the new computer environment – in order to make otherwise incomprehensible technology …
Let's do a quick poll here. What would you rather own if you could choose between a car or a garden? Kevin van Braak combined both symbols of freedom and domesticity into this …
So what to think of this? A toilet spray that mimics the smell of clean linen. It is great in the beginning, yet in time your bed will smell like a toilet. Found in the futuristic …
Scientists at the University of California created a neural implant for a beetle that gives them wireless control over the insect. Electrical signals delivered via the electrodes …
Tyre manufacturing company has come to the rescue of Fuji the dolphin who was stricken by a mysterious life threatening illness and lost her fin. She caught a disease that begun …
Information decoration on a city scale. Every night from the 22 to the 29 of February 2008, the vapor emissions of he Salmisaari power plant in Helsinki will be illuminated to …
I deem you have to be over sixty to have an object with so many historical layers of media in your house. Let's analyze. We are looking at a chandelier in which the candle …
As a kid we used to eat a cereal breakfast with rice pops. On the package of the rice pops there was a little blue bird called Dodo, who seemed to enjoy the rice pops as well. One …
Rather than trying to delay or avoid a flue infection, why not plan it? The INFLU flu collector mask helps you to get sick when you want to. The INFLU mask is outfitted with a …
In response to the Boomeranged Metaphors post of last week, visual wizard Ton Meijdam sent us these foldable icons. Print them, fold them and use them to decorate your 3D desktop …
"Paris, printemps 2019: Oh Darling, you look gorgeous." Nowadays we are so used to Hollywood hyperbodies – a simulation of a body that never existed – it is good to see a …
Japanese design agency To-Genkyo proposes a dynamic freshness label for meat products. The hourglass-shaped label contains special ink that changes color based on the amount of …
Chinese workers slaying monsters to earn gold for western consumers. It sounds surreal, but it is a far from virtual reality for the so-called 'gold farmers', who are working in …
Boomeranged metaphor in the news: Google's algorithm for ranking web pages can be adapted to determine which species are critical for sustaining ecosystems , the BBC reports . …
Though the example product seems a little far-fetched; growth assembly could be quite revolutionary. Worldwide shipping of manufactured things is very inefficient. Why not ship …
So here we are; bragging about our discoveries and great new ways of living... meanwhile we tend to forget that we are NOT the dominant species on the surface of the earth. …
Sometimes you just need to settle with the surrogate. Peculiar image of the week. See also (in the baby series): Infant pillow , We are all born in a world . Thanks Hendrik-Jan .
By highlighting the geometric and mechanical structure of flowers, computer graphics illustrator Macoto Murayama produced these beautiful renderings. These flowers must not be …
In the depths of northeastern India, one of the wettest places on earth, bridges aren't built – they're grown. What could 21th century architects learn from these dynamic …
A Chinese farmer, Gao Xianzhang, has invented baby-shaped buddha pears and he is planning to export his idea. The produce became a success in his local province since people seem …
This snowman (shouldn't there be a broom?) was created by Niall Hamilton, published at microbialart.com . Science becomes art in this experimental collaboration of man, fungi and …
A peculiar photo series by Hubert Blanz . Related post: Lost on the Freeway? , Observing Next Nature , Waves of Asphalt , Interchange , Exploding City , Magic Highway USA .
This snowman is 10 µm across, 1/5th the width of a human hair. The snowman was made from two tin beads used to calibrate electron microscope astigmatism. The eyes and smile were …
Let's try this song to focus once more on the culture versus nature theme: "The Big Idea" by Nataly Dawn . The concept of this song is illustrated by the fact that she recorded it …
Robots are penetrating our homes... disguised as cats? On July 30, Sega Toys releases an el-cheapo simulation cat toy for robot cat lovers with allergies or pet-unfriendly …
Part of the Fallen Princesses series by Dina Goldstein. "These works place Fairy Tale characters in modern day scenarios. In all of the images the Princess is placed in an …
Neo was here. By Kristof Wickman, Tyler Peterson, and Shaun Owens-Agase, November 2004. Source: oodagroup.com | Related: Warp Your Room | Learning to Build Superman's House | …
Never believed in pots of gold anyway. Related: Credit on Color - rainbow of credit cards | Datafountain - money translated into water | Ceci n'est pas une Roche | Faked Fireworks …
With the emergence of mobile phones, classical phone booths are used less and less. Seems like the Dutch telecoms operator KPN is re-tooling its phone booths to function as …
Nice adbust in Berlins subway. Photoshop panels were put over the image to make reassure us that nobody is actually born that beautiful. More images . See also: Photoshop Beauties …
Internet porn graphics transferred to real life objects. A nice photography project by Jean Yves Lemoigne .
After the plant that glows when thirsty , the plant that calls when thirsty , the dataplant , plantvertizing , the emphatic plant and the blogging houseplant , there is now a …
All right I am the first to admit this thunderstorm imitation by the a Capella choir Perpetuum Jazzile isn't exactly what we had in mind when we started our discussion on 'the …
I vividly remember being offended throughout my high-school education because 'atoms' where consistently presented as these perfect slick round little spheres. At one time I even …
We already know that guys love dolls ... Now learn why some mothers can never stop playing with dolls and that cuteness is defined in the mind's eye. Image credit: Kentish Babies …
These college students perform a "live-action" skit of the old school Super Mario Brothers video game at a talent show. Virtual for real in a high school musical (hilarious …
Let the robots do the dirty work! This real-life Wall-E Recycling robot, part of the $3.9 million DustBot research program that is trying to improve urban hygiene, collects trash …
Lenka Clayton : A series of five digitally repaired images taken in Lebanon of buildings damaged by the 2006 conflict with Israel. The images were taken specifically for this …
Tiger meets tiger. Apparently some of the owners of a vacuum cleaning robot feel the need to 'costumize' their device. We are now awaiting the witty bio-robotics company that …
BMW aggressively takes on the biomimicmarketing of Jaguar. Peculiar image of the week. Via Infozaragoza . Related: The Naturalness of traveling with a Jeep , Facing Your Car , …
Scientists at the Eindhoven University of Technology are creating artificial pork. Prof. Dr Mark Post and his colleagues of the department of Biomedical Engineering have extracted …
Subway stations are usually designed in a clean and modernistic style in order to make people forget they are traveling deep underground. How different in the Stockholm subway, in …
The products in the first category have none or only a very weak link with the natural imagery being used: Lacoste is not about crocodiles, Linux is not about penguins, Bacardi is …
The border between the first and the second category is fluid. With the products in the second category, the link is more content oriented. For instance, by calling a sneaker …
The general assumption about sports, is that it's healthy to exercise for a fit and nicely-shaped -- perhaps muscular body. Such a body could be a sign of good health and is being …
GPS is not the most easiest product to advertise. Jeep uses biomimicmarketing to bring the message across. In this advertising campaign an iconic arrow is comprised by images of …
Conspicuous consumption in the overdrive: The world's first refrigerated beach is to be built at a luxury hotel in the Dubai (aka the new Las Vegas) so the tourists don't burn …
... a new McDonalds opens somewhere in the world. Via RebelArt , via Ekosystem . Related: post-apocalyptic religious artefact , hamburger sneaker , Image consumption .
The Triceracopter is half Triceratops, half helicopter. If dinosaurs and technology evolved at the same time, this is what the helicopter might have look like? Built as a …
How can we unfold the Earth? Making a map of the earth is an ancient problem. For thousands of years cartographers, mathematicians, and inventors have developed methods to …
Laurent La Gamba makes photographic installations dealing with camouflage. His work juggles with the idea of natural procrypsis in the urban space and deals with the relations …
No this isn't photoshopped. After a motor accident Finish hacker Jerry Jalava decided not to use a normal prosthesis and felt that a prosthesis usb memory stick would enhance his …
In the classic Milgram Experiment conducted in the 1960s, volunteers were told by an authority figure to deliver electric shocks to another person as punishment for incorrect …
Found sportswear a d, will be reality some day... (with magical goggles of some sort) Related: Recreation in NextNature | Big Ass Search Engine | If Giraffes lived in the US | …
Though its exact definition has shifted over time, the term "wetware" and its fundamental reference to "the physical mind" has been around from the mid-1950s. In its original, …
No, the image above does not some show some collection of freshly genetically designed hypercarrots in various colors of the rainbow. This is the spectrum of colors carrots used to have.
For people who live small... Via Gizmodo . Related: Game on , Games become jobs , Boomeranged Metaphors , Simulating old nature on next nature . Thanks Jurrian.
The most distributed image ever is being phased out. What remains is a hill in Sonoma Valley, California. Charles O’Rear used to pass that hill almost daily between his home in …
Silver, gold or platinum creditcards? Expensive metals in credit card design used to have a certain luster in the past, yet today we are all (painfully) aware the mimicked …
Kentaro Nagai rearranges the world map to create a series of illustrations he calls: "Twelve Animals". Via: PinkTentacle | Related: World Cow | World Mapper |
"In the environment this company will survive for another 500 years." From the advertising campaign of WWF Brasil. Via I believe in advertising . Related post: Wildlife is …
Yes Child. Back in the days, before computers existed, we Googled by postcard. Although it exists for less than 20 years, online search has become such a commonplace activity it …
Remember that aggravating 8-bit pixeled watch icon that used to replace your mouse cursor whenever your Apple computer was ‘taking time’ to finish a task? Displaying a wristwatch …
With his speculative ‘acoustic garden’ David Benqué tries to explore our cultural and aesthetic relationship to nature. He states that the current debate around Genetic …
How could you ever be an anthropomorphobic after you've seen this peculiar image of the week. Thanks Maze .
Mushroom based plastics? Designer Eben Bayer must have eaten too much of the wondrous chanterelles perhaps? No seriously, the man is turning his vision into a reality with an …
This extraordinary concept model that came out of the batcave of BMW shows how textile might be the future of car design. By replacing metal bodywork with a strong but flexible …
No, this is not some solar system far, far away. Closer than you think, this is is a visualization of a botnet storm . For all you know this malicious virus, or one of its …
Don’t worry, your tongue will only stay neon green for an hour or two after consuming Liquid-Plumr-Cardio. Despite the plaque-busting nanoparticles, we doubt whether this is the …
That Next Nature is nothing new can be proven in a walk around Castle Duivenvoorde. The castle dates back from the 11th century, while the gardens date from 1631. In a time where …
Frequent readers of this website might be familiar with our claim that Next Nature emerges from a fusion between the Born and the Made. But now we can add another: the fusion of …
No this is not some stellar system far away. What is it then? Lets make another picture, this time with the flashlight on... ...and we learn the small universe is comprised by LED …
Let's slightly move back to the NextNature theme with an amusing video by Cyriak . And if that doesn't convince you of cows being the superior species... this video most certainly …
Everyone wants to be remembered after his or her death. Some choose to be buried, others to be cremated. The company Cremation Solutions has a new service which ensures you will …
This interactive piece called Boys & Girls was made by artist Job Koelewijn , who invites people to take place in the life size coffin–style Barbie & Ken packages, where …
The Drive in Wheel is an unique and spectacular giant wheel made especially for cars. The wheel is 100 feet high and takes four cars on one trip. City sightseeing has never been …
Researchers have designed bacteria that can produce a special glue to knit together cracks in concrete structures. Technews Daily reports the genetically modified microbes have …
Doctor gets chip. Chip gets virus. Virus infects other devices... Dalek shoots doctor? Dr. Mark Gasson of Reading University implanted a RFID chip under his skin last year. It is …
The US Food and Drug Administration is considering whether to approve the first genetically engineered animal that people would eat — salmon that can grow at twice the normal …
In response to the latest oil spill famed photographer Steven Meisel made a shoot for the Italian Vogue (the only fashion magazine in the world worth reading, really) that …
It is a widespread belief that, contrary to people living in urban areas, farmers have a strong connection with 'nature'. One seriously starts to doubt that after watching this …
This video is a special treat for the tiny portion of our readers who crave for Mcluhan–Wittgenstein cocktails: We recommend you to spend 9 minutes of your valuable time on …
A new nano-particle-infused hydrogel, developed by scientists from Clemson University, should be able to heal scrambled brains and broken bones. The gel creates new blood vessels …
Although most biomimicmarketing strategies are oxymoronic , it is nice to see some people take them full cycle. This Japanese Apple fan found a way to naturally grow and harvest …
In anticipation of the forthcoming Next Nature book, we call upon you, dearest creatives, to submit a fictitious editorial advertisement: The Infotizement. The infotizement is a …
In the series of bio-printer stories this inkjet-like bio-printer seems to be the most convincing product to hit the market soon. It sprays skin cells directly onto burn victims, …
At ISEA 2010 , the International Symposium on Electronic Arts, media artists and media researchers from all over the world present their work in Dortmund (Germany). This year, …
So, you are well aware that biotech will drive our evolution , you took the crash course on synthetic genomics , you've got your map of the DNA world in your backpack and are now …
So you thought augmented reality is something new? Guess you are so attuned to the already existing augmentation of reality that you don't even notice it anymore. The short film …
Superman already knew it: Steered growth is the future of architecture. The lower picture was taken at the Industrias Peñoles nano-chrystal architecture lab in Chihuahuan, Mexico …
Dusting furniture and floors should be history in forty years time, as special bacteria in a yet to develop cleaning product will be eating the dirt. The speculative cleaning …
Now how is this for a Boomeranged Metaphor ? Gene suffers from first person shooter disease, also known as Duke Nukem’s disease. It is such a sadness. See also: When Facebook gets …
At TEDGlobal 2010 , author Matt Ridley argues how, throughout history, the engine of human progress has been the meeting and mating of ideas to make new ideas. According to …
“ Who wants a stylus? ” Words by Apple’s Steve Jobs when introducing the iPhone that uses a revolutionary input device: the finger. And it works wonderfully, yet in some …
Do you suffer from small health inconveniences and do you like to put salt on your morning egg? Why not combine the two? Medicinal All-Salt provides a low-dosage solution for …
Protection is the fundamental purpose of the helmet. This helmet, a conceptual design project by Seungjoo Lee , enables the storage and protection of memories. Plug in your USB to …
In the older days, people had to cross natural barriers like mountains for survival purposes. Grains from one side of the mountain was traded with cloth from the other side, for …
Milk is good for you and we all should drink lots of it. Common knowledge so far, but do you actually know where milk comes from? Supermarket? Factories? Luckily this milk …
Finally a piece of biomimicmarketing (= using images of nature to market a product) that portrays nature as aggressive and destructive, rather than the idealizing and …
Last Saturday, our Nano Supermarket opened its doors in a pleasurably crowded atmosphere. Below are some snapshots of the opening event. If you happen to be in the neighborhood, …
Nanotechnology is an important emerging technology of our time – it radically intervenes with our sense of what is natural – yet most people are still relatively unaware of its …
Now here is something for the NANO Supermarket : Massachusetts-based Draper Laboratories have developed a special injectable ink with nano–particles. This ink eventually could …
As the world is preparing to show off at the World Expo in Shanghai, their pavilions are nearing their final stage. To me, it feels like a lot of them are making references to …
Nature conservation organizations – like the WWF and Greenpeace – typically present nature as a commodity that has become increasingly scarce and will be used up altogether if we …
Nature as math, math as nature. A short movie by Cristóbal Villa . Thanks Martijn .
* warning: high doses of irony detected in this article * Method #01: Canning Promotional gift 'Nature in a can' complete with soil and bean plant seeds (from DKNY , 2010). Method …
How to upcycle old newspapers? Mieke Meijer (a.o.) from Vij5 took a jar of glue and started imitating tree rings. "The product surprisingly mimics the quality of real wood" she …
The main character in ‘Being There’ (1979) is a simple-minded gardener named Chance, played brilliantly by Peter Sellars, who has spent all his life as a servant in the Washington …
The sad story of Timothy Treadwell is the ultimate example of the drama a naive notion of nature can bring about. Grizzly Man (2005) opens with the facts surrounding Timothy …
While the spotting of old nature phenomena in our surroundings – birds, insects, trees, stars, etc – has a large tradition enjoyed by millions, the spotting of next nature …
Hans Jørgen Olsen, a 12-year-old Norwegian boy, saved himself and his sister from a moose attack using skills he picked up playing the online role playing game World of Warcraft.. …
Since the intake of medicines has become a mundane ritual nowadays, why not naturalize the interface? French artist Mathieu Lehanneur is rethinking the pill-person interface in …
Nanowire generators could one day lead to medical devices powered by the patient's own heart. A tiny, nearly invisible nanowire can convert the energy of pulsing, flexing muscles …
In 1977, NASA launched Voyager 1 and Voyager 2, two unmanned interplanetary space probes that were sent out to explore the outer space. Aboard each was a record which intended to …
In our ‘ under the beach lies the pavement ’ series. Already in 1973, Steven M. Johnson drew cartoons of oil drilling platforms disguised to look like palm trees, in an attempt by …
Unsure whether this video by Patrick Jean should be interpreted as an allegorical vision of the utterly transmuting effect the digital has on the physical , or that it is just an …
Mind control for beginners: A mouse expressing ChR2 channels in its neurons starts running when it receives blue light in its motor cortex. Unsure what applications the …
A relatively new kind of marine species is called "Seabreacher" . These watercraft vessels started appearing from 1997 and have been evolving at a rapid pace. Seabreachers enable …
Once upon a time humans told stories by painting on cave walls, showing plays in an amphitheater, pressing text on paper and shining light trough pieces of film. Today we tell our …
Skinpaper is a speculative work by Tommaso Lanza and Vanessa Harden that explores the cross section between a living specimen and paper. "Skin paper is made of breathable …
Urban intervention, naughty boy-style! The public media interventionists of VR/Urban have designed a cool tool to intervene into next nature: the SMSlingshot. A wooden, embedded …
This umbilical cord-inspired charger cable by interactive media artist Mio I-zawa comes to life when connected to an iPhone. Don't watch the video if you are anthropomorphobic . …
Glad to announce that performance artist Stelarc – who already for some decades incorporates themes of cyborgization and other human-machine interfaces in his (very bodily) work – …
As it is Sunday today, lets indulge in a scientific spiritual music video. Created by John Boswell . Thanks Finnigans Riverrun.
We usually just click 'Ok' on every update request, but perhaps the one proposed in this religiously uncanny video by Doctor AlexXross needs a bit more contemplation?
The ‘Decay’ project explores how traces of time and use can be embedded in textile. By wearing a carbon fibre suit over a white blouse, textile designer Marie Ilse Bourlanges …
Haroon Baig from Germany has figured out a way to key up the amount of 50+ Twitter addicts. This progressive nostalgic cuckoo device displays new tweets from any twitter stream or …
Some beautiful "visual thoughts" by NL Architects . On the left: Minimum Speed 200 kh/h. On the right: United Airlines. On the left: desert irrigation made beautiful with this …
In 2009, undergraduates at the University of Cambridge worked with scientists and artists to engineer E. coli into E. chromi , a new type of bacteria that secretes a range of …
When fruit flies die, they don't go to heaven, but they do get to go to outer space. At least that's the conceit of artist HsienYu Cheng's Collector: Afterlife , which zaps bugs …
In this Petcha Kutcha presentation, Mike Dickison comes to a very funny conclusion: Although Big Bird might superficially resemble other ratites like the ostrich or emu, he is …
Indulge in the paintings by Alex Gross . There is 'something' next nature about them... If happen to have more information on what that 'something' is, feel free to enlighten us …
Technology is evolving us, says cyborg anthropologist Amber Case in her 8 minutes of TED . We become a screen-staring, button-clicking new version of homo sapiens, relying on …
That's no reindeer, and it's certainly no moose. It's an Irish Elk, Megaloceros giganteous , a deer that happens to be neither an elk, nor really all that Irish. What it does …
The Anthropocene is the recently proposed epoch of Earth history that, proponents say, has begun with the rise of the human species as a globally potent biogeophysical force, …
Parks becomes fairground attractions? Maybe they have been all the time. This intriguing park design by architecture-firm-beyond-praise Diller Scofidio + Renfro seems (who we all …
According to a research by JWT AnxietyIndex the changing mediascape is upon us. Do to the recession people are forced to validate their luxuries and it turned out that teens and …
Coming saturday, your faithful Next Nature editor/designer Hendrik-Jan Grievink will perform Beyond Recognition – a corporate poem about the image of words , at Sameheads Gallery …
Unfortunately your forest experience does not meet the highest standards at this moment. We are working on a solution and hope to resolve this issue very soon. Our sincere …
A 'treasure in the trees' reveals the exchange of materials between man and animal. This beautiful house finch nest, made of natural resources and manmade garbage, demonstrates …
In the short movie Blinky, on a boy and his robot, director Ruari Robinson reflects on our daily dealings with technology and its risks. Alex is a child growing up in a family …
Lucy McRae uses spandex to deterritorialize the body. #powershow #bodyart http://bit.ly/th7KyR
In this video, Geert Mul uses online photos to tap into the divine presence in image search #powershow http://bit.ly/uk79b0
In March, Mazda recalled 65,000 cars, not because of any structural faults in the vehicle, but because the engineers had inadvertently created the perfect habitat for a tiny …
Inspired by crickets, researchers of the MESA+ Institute for Nanotechnology of the University of Twente in the Netherlands have build a biomimetic sensor that can measure changes …
Back in 2009 Rob Spence, a cyborg film maker, worked together with a team of ocularists, inventors, engineering specialists on a prosthetic eye which can capture and stream video. …
Our historical snippet of the moment is a Canadian television fragment from 1968 featuring a debate between Norman Mailer and Marshall McLuhan on the implications of media …
Matrix-style learning sounds like an impossibility, yet new research suggests it might become reality. Boston University and ATR Computational Neuroscience Laboratories in Kyoto …
From Dinosaur to primitive bird to supermarket discount. Although chickens thrive as a species – in the sense that billions of them roam the earth bio-industry – we doubt if the …
Finally... A gas station in the ocean! If we all rigorously continue filling up our tanks, this fiction can become a reality one day. This is not a photoshop, this is our peculiar …
Artistic duo Robococo, aka Petra Gemeinboeck and Rob Saunders, have embedded a group of autonomous robots in the walls of a gallery. Wielding hammers and creepy electronic eyes, …
This trailer for the mockumentary Ghost With Shit Jobs shows a could-be-future in which the role of the West and the East is reversed. Very good timing I would say. More on: …
Japanese artist Tokujin Yoshioka does not sculpt his work, but grows it. His Venus chair was created by immersing a plastic mesh substrate into a tank filled with a chemical …
The zoomorphic designers of Festo , whom you might know from the robot penguins and a robotic elephant trunk , now managed to decipher the flight of birds. Their prototype is …
By nature, man is not meant to fly. But while we're at it, we may as well turn it into an experience . Charles Champion, Airbus Executive Vice President Engineering, envisions a …
In this TED talk, Kevin Slavin explains how computer algorithms are breaking free of their virtual habitats and changing the physical world to their liking. Through algorithms, …
Remember the movie Eternal Sunshine of the Spotless Mind, where Jim Carrey removes his memories of a relationship with Kate Winslet? According to researchers at the University of …
Why wait for old nature to give us rainbows when we have so many ways of making our own? The image above shows solar-powered installation that uses recycled rainwater to create …
Biomimic marketing brought back into the fruit shop. Hilarious sketch from BBC's The One Ronnie . Thanks Jeroen van Meij.
Nature is a terrific marketing tool and corporations know this. Somehow the natural reference provides us with a familiar feeling of recognition and trust. We call this phenomenon …
Today, 122 years ago, on 13 september 1899, Henry Bliss became the first pedestrian known to be killed by an automobile in North America. Although not the first, he was certainly …
No, the peculiar image above was not created by an in vitro fertilized child from the combined DNA of Escher, Mondrian and Pollock, but rather by 21th century designer Remco van …
Over the last few days the Next Nature website has been suffering symptoms of dementia due to a hardware failure at our very fancy and luxurious web hosting provider Media Temple …
There’s nothing quite like peeling a piece of fruit, but if you end up with a bottle of Vodka after peeling, you know you have been caught in a biomimicmarketing fantasy. I guess …
Filed under Biomimicmarketing . Pleases your inner monkey. Peelable banana ice cream by Nesle . Thanks Jurrian.
What happens if your childhood experience of your environment has been solely through video games? According to artist Shawn Smith, "pixels became a sort of map from which to …
Last November the Next Nature Power Show rocked Amsterdam with a roller-coaster of performances from artists, scientists, designers, writers and architects. This two minute …
Digital pigeon post its private, peaceful, none-polluting and secure. Peculiar image of the week. Via Rising Tensions . Thanks Marco .
The appliance company Bosch claims that its new technology keeps food so fresh that meat from the Ice Age (and presumably the Cretaceous as well) can be stored without incident …
This disposable aluminum barbecue on top of an original Weber barbecue nicely illustrates how people – time after time – employ technology to make life more convenient while …
#! Possibly the answer for blind people with cynophobia, the fear of dogs. This robot guide dog is stil a bit slow compared to the old nature version, but as technology advances …
For past entries and an introduction to the 11 Golden Rules of Anthropomorphism and Design, click here. What people experience as anthropomorphic is highly personal. Tests have …
For past entries and an introduction to the 11 Golden Rules of Anthropomorphism and Design, click here. Making good use of anthropomorphism isn’t easy. As you’ve probably …
In a cheerful attempt to investigate and subvert the image consumption power structures of the contemporary supermarket , designer Marco Ugolini and photographer Pedro Motta went …
For just £1.19 ($1.99, €1,59) you can download an app for your iPhone which offers tips and guidelines with the sacrament, "the perfect aid for every penitent" as the description …
Earlier we've posted the Bulletproof Skin , now here is the Skin Gun : a stem cell spray gun used to heal burn victims. It is up to you – dear intelligent readers – to image if …
We've previously featured architecture that imitates nature by opening its walls like a flower , or drifting like a cloud . However, maybe this is not imitation enough. The next …
Last week, the young and talented designers of the Next Nature lab at the Eindhoven University of Technology presented their end of term works in an internal exhibition. There are …
MyMicrobes , interestingly dubbed "Fecesbook" by ABC News , is the new social network for your gastrointestinal bacteria. For only $2,100 and a bit of poo you can become a member …
The All Streets map visualizes of all the 240 million individual road segments in the United States. Although no other features — outlines, cities, or types of terrain — are …
Swallowable Parfum is a digestible scented capsule that works through your own perspiration. Once absorbed, fragrance molecules are excreted through the skin’s surface. A unique …
Kevin Kelly, Senior Maverick at Wired Magazine talks about the nature of technology and propose to define technology as the 7th Kingdom of Life.
Our proposal to study the financial system as an ecosystem is sometimes criticized as 'abuse of vegetational concepts'. Interestingly enough BBC documentary maker Adam Curtis now …
Christien Meindertsma spent three years tracking down every product made from a single pig. Pork made a showing, but the more strange goods were "ammunition, medicine, photo …
We already know that bananas are evidence of intelligent design – by farmers, not by god. All commercial crops have been tweaked by the hand of agriculture, but modern bananas …
" The Institute for Digital Biology researches next steps in the evolution of the internet, where websites and services develop into living creatures ." This scenario lives in the …
Ever wished you could take a shower with pigeon poop? Artist Tuur van Balen proposes changing pigeons from flying rats to cleaning agents. A speculative, specially engineered …
Some people like berries, some like tomato's. So what do you get when you get when the two mate? Indeed, the latest hyperfruit spotted on the selves is the Tomberry . This …
From the exhibit "What Machines Dream Of" in Berlin comes Life Writer , a work by Christa Sommerer and Laurent Mignonneau. As the participant types, letters are projected on a …
This project explores the invisible terrain of WiFi networks in urban spaces by light painting signal strength in long-exposure photographs. A four-metre long measuring rod with …
It’s good to know that also our favorite fairy tale creatures have their bad days, awkward moments and do not always fit the perfect picture that we created for them. Via Who …
In The Watchers , the creative geniuses at Studio Smack picture a world where surveillance systems don't just watch us - they actively judge. Are you a green-coded Conformist or …
They remind us of ourselves We love their dexterity - thanks partly to that "pseudo thumb", which functions as a sixth digit. It's in the eyes We love their big eyes because it …
Part 11 of the series 11 Golden Rules of Anthropomorphism and Design Anthropomorphism can be a powerful tool in product design. But there are also risks involved that urge …
Earlier this year, Belgian surgeons successfully performed the country's first full-face transplant using 3D printing. The operation was conducted by a medical team of Ghent …
Long for farm-fresh eggs on the table? Dream about going to bed each night worrying about racoons, rats and foxes? Like the feeling of scraping chicken shit off your hands? For …
Artist Willis Elkins "rescues" plastic detritus from the sea. His most recent venture, the Jamaica Bay Pen Project , retrieves sun-baked, useless pens from the shores of New …
Text for blind people using the Braille alphabet has been around for some time. But instead of making separate books for the visually impaired, why not change the way we all read? …
A team of researchers from three universities have succeeded in creating the first device that boosts the brain power of primates. In the study, five rhesus macaques were trained …
Having trouble getting the kids to eat their fruits and vegetables? Try turning their 5-a-day into a trendy, collectible toy. We've seen Buddha fruit and square watermelons …
With areas of New York still without electricity, BioLite recently came to the rescue of Brooklynites by setting up a charging station with camping stoves that convert excess …
Another step in the fusion of the made & the born: What if we could simply print new organs for use in clinical trials?
Wild salmon gets its robust pink color from a diet rich in red-hued krill. Farmed salmon are fed on fish meal, chicken byproducts, soybeans, wheat and a long list of other …
La Pâte Meat Fruit aims to seduce and inspire diners with an entirely new eating experience that balances eating meat and fruit. In vitro technology is used to grow meat …
In some parts of Australia it is no exception to hear voices when there are no people near. The voices are the chatter of wild cockatoos that where taught words and sentences from escaped domesticated cockatoos.
During the coming weeks, we will present a selection of our favourite pages from the Next Nature book . This week the thirs one in this series: Tomorrow’s Fossils. Ode to the car …
During the coming weeks, we will present a selection of our favourite pages from the Next Nature book . This week a tool that encourages us to experience local specialties through …
During the coming weeks, we will present a selection of our favourite pages from the Next Nature book . This week, after nation branding, the brand nation. Entering the store or …
Biological physicist Gabor Forgacs normally works on the “printing” of new organs for use in clinical trials, however, his technology could also be used to bioprint meat. In the …
Whale sharks are great at filtering; plastic needs to be filtered. For now, however, whale sharks only have an appetite for plankton. Industrial designer Elie Ahovi has jumped …
Image consumption in the overdrive. Peculiar image of the week. Created by Erin Murphy, Victoria Bellavia, Yong Jun Lee & Sanggun Park . Thanks Jeroen van der Meij.
Back to the natural future? A startup company in Oregon is manufacturing bike helmets made of wood and cork that should meet or surpass the impact performance of plastic and foam …
Thanks to the collaboration between Makerbot and TeamTeamUsa new biodegradable shells are printed for hermit crabs.
Plastic is a part of the earth's ecosystem , but it's a part that no one wants. At Harvard, scientists are looking to replace single-use plastic bottles, plates, and cups with …
Have you heard of Elephantiasis? It is a disease caused by microscopic parasitic worms that cause a thickening of the skin and underlying tissues. The disease typically occurs in …
Body-mod enthusiast David Hurban has decided to make a lifelong commitment to his iPod Nano. By implanting magnets in his wrist, Hurban has created a permanent bracket to hold his …
Why does your food look different in advertising than it does in the store? A Canadian McDonald's marketing manager tries to answer this common question with a behind-the-scenes …
As advances in nanotechnology bring us increasingly energy efficient products, plant life such as algae could become attractive sources for tapping energy. The Latro lamp by …
Know garlic? Now imagine we could make something that functions alike, but smells a lot better. That's what Swallowable parfum is about.
Nothing beats the factory-scent of expensive, freshly unboxed technology! Artist group Greatest Hits produced the Apple Unboxing Scent for use at an exhibition in Melbourne, where …
Last week I had the pleasure of being the studio guest at the Earth Beat radio show. I was treated with examples of 'artificial nature' and asked to respond from a Next Nature …
Indeed, the supermarket is our next savanna . Peculiar image of the week. Thanks Jeroen.
"Earlier today, certain realms were affected by an in-game exploit, resulting in the deaths of player characters and non-player characters in some of the major cities," wrote a …
Our peculiar image of the week is exemplary of our human longing for technology that intimately integrates with our body & senses. We are all cyborgs .
With Energy Belt, stop treating your excess fat like a liability, and instead embrace its untapped potential. Artificial protocells in the belt mimic natural brown fat, taking …
350 million years after crawling from the sea, the Lungless suit will bring us back. Inspired by fish gills, the Lungless Aquatic Respiration Suit uses millions of cascading …
For years, people have relied on harsh drugs and irritating alarms to control when they sleep and when they wake. Now, the Nansense wristwatch offers an all-natural way to …
Breast cancer is a disease that comes with feelings of helplessness and loneliness. This nanotechnological necklace allows you to regain some control regarding your disease, in …
We call upon designers, technologists and artists to submit their speculative nanotech products for the next round of the NANO supermarket.
Sneak peek into your nano future with the brand new NANO Supermarket TV Commercial.
From sleek fashion to life-saving medicines. During the forthcoming Dutch Design Week , our lustrous NANO Supermarket debuts a new line of speculative nano products that might hit …
Designed by Luc de Smet, Awear is a speculative bracelet that can detect and record the sources of allergies for children in uncontrolled environments, such as schools and …
No, those aren't plastic trinkets or beads from a craft store. They're diatoms, a group of single-celled algae, and unlike almost all of our current technologies, they can rapidly …
Growing up, I had a cockatiel that could mimic the bleeping cacophony of a dial-up connection with dead accuracy. I never stopped to think that my bird (still alive) preserves a …
Some months ago the Rotterdam Think Café organized a Next Nature night featuring a prominent nextnature connoisseur.
The Senseless Drawing Robot is a painting robot that interprets nearby street and sidewalk traffic and turns it into sprays of pigment. The robot is turning chaos into order, and …
More hypernatural designer-fruit. What do you get when you cross a strawberry and a pineapple? A pineberry, of course. Some seven years ago the pineberry was taken from its native …
We spotted these hypernatural rainbow roses at the train station in Utrecht . Indeed they look a bit over date, I guess drinking rainbow ink doesn't make them last any longer. …
What most gourmands would define as "real" and "natural" vanilla flavoring is simple: Vanilla beans steeped in alcohol. But vanillin, the chemical responsible for vanilla's taste …
Now here is an hands-on example of ‘guided growth‘ as a way to steer complex systems.
Always good to see a swimming pool exactly where you need it. At San Alfonso del Mar resort in Chili they know how to cater people that love nature – except for the rocks, bites …
Apparently the marketeers of Bacardi expect the combination of bats, berries and dragons should help to successfully promote the alcoholic sugar drink in the shops.
Functional multi-tool manicure. Comes in handy at a party where you can't find a bottle opener. Peculiar image of the week. Unfortunately, neither the human responsible for the …
Silence is a thing of the past. Just as no place has been left untouched by climate change, there is no place on earth that is not 'polluted' by the sounds of planes, ships, and …
Displays have been on our desks for too long. Samsung makes space and introduces the Transparent Smart Window . This LCD touchscreen is powered by the sunlight shining from the …
There are many people in the world for whom, for various reasons, it is impossible to leave the house or hospital. This means these people are not able to go to work or school. …
Nanocrystalline cellulose (NCC) sounds almost too good to be true. The same microscopic particles that help trees to stand up straight are also lightweight, non-toxic, stronger …
Retailers have long known that certain smells get us into the buying mood – cinnamon or warm cookies around the holidays, for instance – even if we're shopping for completely …
These stones were dug up by future archaeologists, some centuries after the integration of the digital and the material world was completed. No seriously, our peculiar image of …
Can you do it? Do finish your lunch before clicking the link – or you might vaporise. The video was made by Jason Silva for the ongoing TEDGlobal 2012 which has Radical Openness …
Watch human and urban life evolve in this 3-minute journey through the last 250 years of our history, starting at the beginning of the Industrial Revolution.
At the Next Nature Power Show 2011 our master of ceremony, Koert van Mensvoort gave a mini lecture on our changing notion of Nature.
For his Made of Myth series, Marc Da Cunha Lopes goes back to the places where the elements of great game classics were made. You really didn't think it was all virtual, right? …
This stunning graphic, courtesy of Nature & More , shows the astonishing drop in food crop diversity from 1903 to 1983. Lettuces available from commercial seed houses now …
Bioethicist Paul Root Wolpe presents a parade of recent bio-engineering experiments, from glowing monkeys , to genetically boosted salmon , to cyborg insects . He asks: isn't it …
During the coming weeks, we will present a selection of our favourite pages from the Next Nature book . This week: The World Card Wood, the worlds' most prestgious and versatile …
It looks like a normal soccer ball, but Soccket has a secret: a hole for a charging cable. Designed by two Harvard students, the ball has a pendulum-like mechanism inside that …
In what's probably the most fun form of environmental protest ever, Banksy has created a morose-looking dolphin ride to protest the BP oil spill. The ride is complete with fish …
A fundamental philosophical question, how do we know my blue isn't your yellow? The current human and "natural" understanding of color is fundamentally based on a …
"Atmospheric energy" has the power to revolutionize the production of electricity.
Living lamps like Latro Algea Lamp by Mike Thompson are nothing new. But design studio MADLAB has created Bacterioptica , a lamp that contains organisms and bacteria from the …
Cliff swallows, as their name suggests, like to build nests on cliffs and other rocky outcroppings. They also like building their nests on bridges and overpasses, and sunbathe on …
With rising energy costs and our growing arsenal of iPads, smart phones, and wearable monitors, we're always on the lookout for new ways to power our devices. Perpetua Power , an …
Looking at this nextnatural comic, our co-evolutionary relationship with technology might need some work.
Samsung is working on a brain interface that lets you go truly hands-free with your phone.
A 23-year-old in China was recently puzzled why his online avatars were being killed off at disproportionate rates. After asking around, the young man eventually discovered that …
A new device replicates the kicking and moving of a baby inside a mother's womb.
Tikker, the watch that counts down your life, shows the amount of time you are estimated to have left.
Watch your back: the Disney princesses are feeling murderous.
Mesmerizing drone ballet from Kmel Robotics and Lexus.
A cigarette butt imbued with seeds grows flowers when it's discarded in dirt.
In future electric cables could be made ??of spider webs. 100% natural electric cables, sounds like an oxymoron, but it’s possible! Researcher at Na tional High Magnetic Field …
Kate Darling argues that society needs to update its ethical landscape to include thinking machines.
A while ago I tried to make a landscape paintings as seen on the Bob Ross television show, yet thing turned out a little bit different in my wilderness. Nature is perhaps the most …
WWF teams up with designers to produce fur from imaginary animals
A new implant lets blind people see letters, crosswalks and people.
When does a rose not smell as sweet? When it's a Patagonian toothfish.
Designer Michal Marko created a biodegradable food bowl. Can you imagine this bowl being used in fast-food restaurants?
The pictures of Google Street View come to life.
Google Maps preserves a place that's too dangerous to visit.
Which candy bar you choose depends on the color of the packaging.
Famous Parisian landmarks are home to hundreds of thousands of bees.
A so-called "natural" beer is marketed by portraying an utterly technological process.
Next, we are anticipating recipes on how to turn pork into dinosaur filet.
The rise of digital currencies reduces the need for physical interaction and communication between people. At the same time every payment method still leans on trust. But how can …
#t=103 Since 1948 the World Meteorological Organisation has been naming hurricanes and tropical storms. "ANDREW", "SANDY", "IVAN", "KATRINA", to name a few. But what did these …
By attaching to the vagus nerve, a chip can contribute to "natural" weight-loss.
Digestible Microchips are now approved by the US Food and Drug Administration.
A Facebook version of Monopoly forces players to interact with each other in meatspace.
Data doesn't live forever – and a new breed of archeologists are trying to recover it.
Buckle up for a new series of videos from performance philosopher Jason Silva.
Pick up your $100,000 to materialize your revolutionary vision. This is not a spam message.
Who better than the king of the jungle could have been testimonial on the Next Nature Appzine for iPad ? We were pleased to receive this video from the Lion Man, who passionately …
How incredible would it be to imagine a thing and have it magically appear in concrete form? After food , organs and virtuality , here comes the thought printer! Thinkerthing , …
Last week, Next Nature Lab had the first Meat & Greet to explore the future of in vitro meet.
If you're a fish, and want to keep your original tongue, better keep your mouth closed.
Some 300 million years ago, all countries were united in the Pangea continent. Unfortunately at the time there weren't any nature preservation organizations around it to protect and it drifted apart.
Genetically modified glowing sheep make it harder to count sheep at night.
The oldest evidence of cold food storage dates back to 1700 BCE.
In 1995, the US FDA (Food and Drug Administration) approved the use of in-vitro techniques for commercial meat production, paving the way for lab-grown meat products to make their way to the market.
The very first restaurant to typify the modern fast food genre was White Castle, who opened their first location in 1916 in Witchita, USA. Ironically, at the time fast food was …
New in our store: Two very next natural issues of Volume Magazine.
London Real interviewed Koert Van Mensvoort on the concept of Next Nature and its implications on our planet.
An olfactory device for Smartphones that spreads the aroma of barbecue using an app.
I gathered this hand full of tiny pieces of plastic on less than one square meter of beach in Greece (map) . Spotted with the Next Nature Spotter iPhone app .
A new strain of purple GM tomatoes last longer on shelves and help out cancer-prone mice.
Yes grandchildren. Back in the old days we used to *read* books.
Why native Hawaiian people are killing off native Hawaiian monk seals.
Once common, statue-loving has disappeared from the sexual landscape.
Sensors, a communication interface and an actuator for tactile feedback all hidden ina wig.
For NSA, spying on you isn't enough, they monitor your avatar too.
Should plants be genetically controlled to perform specific functions for us?
Help us realize the in vitro meat cookbook and be part of the future of our meat!
A raft of swans blithely adopts an artificial habitat.
Researchers in Tokyo have developed an artificial womb (for goats).
Blade Runner becomes reality in China. Just try not to breathe.
An astounding tangle of multi-colored water flowing throughout 18 arteries represents what happens every day in the pulsating heart of Tokyo. This is how Takatsugu Kuriyama , from …
Advertisers have figured how how to induce auditory hallucinations into your morning commute.
An implant equipped with an accelerometer can tell when you're chewing, chatting, smoking or sipping.
Filter and recover antibiotics from drinking water using only bacteria, water and sunlight.
Forward to nature. Some of the most important aspect of life remain unchanged
Viktor Hertz put a painfully honest (and funny) spin on corporate logos.
Helsinki tested out a Facebook-like interface to get public opinion on a new construction project.
Scientists are using virtual reality environments to help people quit smoking.
Beekeepers in France have been puzzled by their bees producing blue and green honey. Turned out the bees were eating waste from an M&Ms factory.
The Paleo workout replicates the fitness regimen of our caveman ancestors.
A new book explores who (or what) gets to define what is "natural".
Buy the In Vitro Meat Cookbook with free worldwide shipping and gift-wrapping with the Corporate Animals paper included.
Tuscany is known for its natural beauty. But only a few know that this wonderful landscape is actually a really good design work.
Yaybahar is an acoustic instrument that emits sounds like a music synthesizer.
A map of the most visited websites in each country. Google or Facebook, which one will conquer the world?
The ambulance drone: an autonomously navigating mini aeroplane that can quickly deliver a defibrillator.
Anti Drone Tent is a small construction of emergency blankets that blocks infrared sensing, making it invisible to drones.
The façade of an Indian temple constructed from a large-scale print of a Facebook Wall.
The tiny patient lying on the operating table is a goldfish.
Smog-busting roof tiles could clean tons of pollution.
Digital natives have trouble understanding life before 24/7 online connectivity.
The dissected motorcycle learns us that, like in old nature, much of the inner workings of next nature are occluded to us.
Photographer Holly Wilmeth seeks to capture the encounter between women and nature, symbolized into animal form.
During a triathlon ace a drone operated by a local photographer hit one of the athletes.
The online course to get your drone driver’s license for civil use.
Dutch girl fakes an exotic holiday with the power of Photoshop and Facebook.
Daan Roosegaarde is exploring possibilities to replace streetlights with luminous trees.
A new artificial mineral made of technological artifacts, such as computers, tools and machinery.
In the Ruriden cemetery, in Tokyo, over 2.000 Buddhas statues are illuminated by high-powered color changing LED lights.
Without social bonds and solidarity, anything can and does happen: a small house surrounded by new big buildings.
On the 5th of August, one year after the lab grown hamburger, the In Vitro Meat Cookbook will be presented in Amsterdam.
The length of a muscle fiber was once limited by the size of the animal it was growing in. Now, freed from the constraints of the body, it’s possible to culture “thread” made from long strands of muscle tissue.
The home incubator does for cooking what the electronic synthesizer did for musicians.
Meat fruit combines the femininity of fruit with the masculine sensibilities of red meat in a hybrid celebration of our post-patriarchal, post-gender society.
If vegetarian products can mimic meat, then why not the other way around?
Bone pickers stimulate your 'inner caveman'. They satisfy our carnal appetite for gnawing and ripping.
1.5 million balloons were released in once to create a spectacular show becoming uncontrollable and dangerous.
Drones are typically thought of as flying spying robots, or even worse flying spying shooting robots. But could we also employ drones for good? The people of …
Japanese engineers plan to turn the moon into a giant solar panel station.
Magic meatballs playfully familiarize children with the concept of in vitro meat.
Photographer Kim Preston transforms everyday household plastic objects into sea creatures.
Textiles manufacturer 'Vlisco' updates African classic pattern to represent personal educational preferences.
Pawel Kuczynski portraits the contradictions of today’s world.
Truly advanced technology will be light as sunshine and indistinguishable from nature.
At times it seems we serve our technology as much as it serves us. The OFFTIME App wants to save us from our own devices.
Occasionally you bump into an image that seems related to our next nature quest, but you are unable to verbalize.
Studio Roosegaarde created a giant rainbow of light for the Amsterdam Central Station east side.
The EU Commission will hopefully reduce the consumption of disposable plastic bags within 5 years by 80%.
Bioengineer Drew Endy shares his idea of biology as a precision manufacturer that could potentially transform civilization as we know it.
In 1925 futurists envisioned a sort of aerial civilization in the sky of New York City.
Researchers created a robo-feline able to run and bound while completely untethered.
Maybe in the future swarms of robots could help cleaning oil spills, provide immediate emergency help at a disaster or guide millions of self driving cars.
A robot that applies computer controlled motion to precisely decorate your Easter eggs.
A cannon that sucks salmon up and “shoots” them out in a different body of water.
Hy-Fi, a structure built from a combination of corn husks and fungus.
Will these futuristic signs become part of our near future?
People have complex relationships with their own (and other’s) bodies. In Traditional Chinese Medicine (TCM), it is believed that your feet are a map of your body and can provide …
The rise and fall of the Earths forests can now be tracked 'real time' through a new mapping tool called Global Forest Watch.
What if we could drink from a giant drop of water? The bottle of the future has the shape of a soft, hygienic, biodegradable and edible blob.
Julian Melchiorri created a synthetic biological leaf that absorbs water and carbon dioxide to produce oxygen just like a plant.
From automobile to airplane: the flying car is built to travel as easily on the road as in the sky.
Your next phone could be the noPhone: a technology-free alternative to any smart mobile device.
The Moodmetric ring measures the autonomous nervous system signals that can be used to understand emotional reactions and improve quality of life.
The series Museum of Selfies combines the original art of portraiture with its modern counterpart, the the smartphone self-portrait.
Stretchy artificial skin lets prosthetic hand sense heat, humidity, and pressure.
The smog in Beijing has become so thick that only place to hail a sunrise is on the huge digital commercial television screens across the city.
37 of the world’s 100 largest economies are corporations.
A virtual reality headset could give chickens the freedom to roam without the roaming.
Social roboticist Heather Knight explains why we should give robots personalities.
Although there seems to be no effective drug in use to cure malaria, a scientist robot named Eve may have found a cure.
We don’t have to leave our homes to do groceries, buy new clothes, furniture, or anything. We can buy everything online!
No longer is the perception of the analog limited to its physical elements.
In search for information people once used to go to libraries.
Browsing through your virtual bookshelf gives you the feeling of having an easily accessible collection of books, just like your good old analog one.
The Analogue vs Digital Memory Game explores the different ways of seeing, thinking and experiencing across the digital divide.
Before global positioning systems, we all used maps. And they could be very annoying.
The image on the left is a car, as we know them. It has a lot of digital technology in it already, but not nearly as much as the other one.
Floppy disks have not gone extinct yet. You might not realize, but you are clicking on them every day.
Some modern thinkers argue that new technology is making us antisocial.
CDS have been largely replaced by digital downloads and mp3 players. Conversely, vinyl sales have begun to grow.
Florian Mehnert, A German artist, has launched an experiment that will give internet users the power to shoot a rat with a single click on their keyboard or smartphone. A …
These paintings by Johnny Abrahams look almost computer made - except they are not. Working mainly with black and white acrylic paints and with a lot of patience, the American …
Cultivator is speculative design project on how bioprinting could find its way into the kitchen of the future.
Would you be able to recognize these logos if they were in Chinese?
Swimming salmon fillets confuse educate children about where dinner comes from.
Dutch developer Jeffrey van der Goot got questioned by the police after one of his Twitter Bot released a tweet containing a death threat.
The fish swimming in this aquarium are unaware part of the Flowers and Fish art installation by Japanese digital studio teamLab.
Ever feel the need to hear two digital mountains read your tweets aloud with deep and sonorous voices?
Warka Water is an alternative water source to rural population that faces challenges in accessing drinkable water.
America artist Mac Cauley created a new way to experience the painting in virtual reality.
The popular social network icon has been turned into a potentially lethal narcotic substance.
Dutch architect Chris Collaris and designers Ruben Esser, Sander Bakker and Patrick van der Gronde, saw a new sustainable potential in discarded mega oil tankers in the Southern …
Games are typically played to escape our dull or stressful everyday reality, yet they are also made to become increasingly realistic.
We may soon all be making natural gestures to interact with our digital devices.
The exterior of the this hotel room is constructed with branches, sticks and twigs intertwined to create the look and feel of a real bird nest.
Biologist Alina Schick developed trees that grow sideway, instead of growing upwards.
Google filmed the most recent NYC Veteran’s Day Parade in 360-degree video and created a VR version that would allow disabled or ill-healthed veterans to experience the parade as well.
Naomi Kizhner designed jewelry that can theoretically harvest energy from the body of the person wearing it.
There is now a new application that allows random people to cheer you up on Twitter.
Japan city has launched an online street view map to introduce the view of the city by a cat's perspective.
Coelux skylight recreates natural sunlight using Nano Technology.
French visionary architect Jacques Rougerie designed a utopian floating city shaped like a manta ray.
The multidisciplinary design consultancy Antrepo Team created a project named Minimalist Effect in the Maximalist Market in 2010.
Our lustrous NANO Supermarket opened a 100m2 pop-up store in Stavanger, Norway.
Transforming Northern California waterfalls into a psychedelic scenery using a colorful range of glow sticks, lasers, road flares, headlamps.
Next Nature Night on Design & Evolution, Tuesday 30th June.
The Random Darknet Shopper, with bitcoin to burn, has purchased counterfeit jeans, master keys, dodgy cigs and even a bag of ecstasy tablets. Who is legally liable?
Large Hadron Collider in Geneva will attempt to detect or create mini black holes, to reveal a new universe.
A microbiologist has developed a way to make the cracks in concrete structures heal themselves.
These parents use the Apple Watch to share their newborn child's heartbeats with friends and family.
When there is such abundance of areas where IoT could be applied, several ridiculous, unnecessary products are inevitable.
Grasshoppers are a sustainable and cost-effective alternative to meat protein. Could the ability to grow them in your kitchen make them more appealing? Watch the video below and …
Meet the anti-smartphone. It literally does nothing but make and answer calls.
A virtual reality theme park where visitors can explore the virtual world in a physical environment.
Researchers Fernandez and Ingber imitated chitin in order to produce durable, biodegradable plastics.
The Bored and Brilliant project asks people to measure their smartphone use take some conscious steps to limit the digital interactions.
he WiFi Angels app lets you sense electromagnetic radiations by turning the WiFi networks around you into a celestial choir.
Your cat might be able to take photos and share them on Instagram by itself soon.
TThe Dictionary of Obscure Sorrows defines anemoia as the felling of nostalgia for a time you’ve never known. This word may not be frequently used, but it describes a common feeling.
Adblock Plus, world’s most popular ad-blocking tool, just announced they are launching an advertising service for “acceptable” ads.
Fake photography, or fauxtography, has been around since the invention of cameras and nature is one of the most popular subjects of dishonest photographers.
Swiss artist Dan Acher created a replica of the Northern Lights by way of high-powered lasers.
Thousands of bees chased a Welsh woman's car for two days looking for their queen.
Biomimicry is a documentary on the topic of how life and biology can be the mentors for our own innovation in the world.
When you think about a tree, you image it growing on land. Though the team of Mothership wanted to challenge this image by creating the Bobbing Forest in Rotterdam.
The Salt Project created an additional ecosystem to revive desertified lands.
What if a camera would say "no" when you press the shutter because there are already too many similar photos on the internet?
Last week nearly 70 portraits of cats replaced all advertisements at the Clapham Common tube station in London.
Icelandic Product Design student Ari Jónsson has used red algae powder and water to create a biodegradable water bottle.
Disney’s latest attraction? 300 drones flying in formation.
Drone racing: a new sport, where competitors drive drones at a speed of 70 mph. They control the drone by distance, using video goggles.
An eagle clutching a flying drone is probably not a show that you see everyday, unless you live in the Netherlands.
The realization that the volume of the Earth would fit over a million times in the volume of the Sun kind of makes you modest. No, we are not the Masters of the Universe.
Researchers at Carnegie Mellon University are developing edible batteries to power ingestible medical devices for diagnosing and treating disease.
Sweden hosts the World's first electric highway for trucks, giving hope for the future of fossil free transportation.
Engineer Sonam Wangchuk created fake glaciers that are already improving the life of people in Ladakh, Himalayas.
Due to an algorithmic error, Facebook mistakenly "memorialized" vital user accounts with a banner announcing the user’s passing – turning their friend walls into memorial walls.
ching 64GB SD cards to each of our fingers challenges how we store and share information in a world were our digital privacy is at risk.
The eco-friendly food packaging material able to improve food safety, conservation and quality.
Researchers are teaching drones to recognize and follow forest trails.
CRISPRy cabbage has been served for the first time in the world.
The Ocean Cleanup Foundation’s prototype floating barrier wants to clean the oceans water.
Martin Roth brings Persian rugs to life with the cultivation of grass.
A speculative rendering of a climate change catastrophe? Is this our future? Or our past, long before people starting building dykes in the low lands?
Megasus horse runners created the horsesneakers aimed to help horses and riders to deliver a better performance in sports.
The recently opened Noor solar power plant is now the biggest in the world. It will power Morocco and if everything goes as planned imported solar energy can be a reality too.
The eggplant emoji became a political weapon and gain cult status being the forbidden fruit of the web.
Symbol of the stalled development in the socialist state, or design for silence, quietude and meditation?
The penguin jumper is designed by the Penguin Foundation, an organization that rescues penguins on the Australian coast who are hit by oils spills.
Our Bistro in Vitro Ice Cream Cart took off for the Spring/Summer season in Vondelpark, Amsterdam.
American chocolate manufacturer Mondelez reduces the weight of its widely popular Toblerone bars as a result of the Brexit vote.
How will the future perceive our so-called modern VR technologies?
$1.3 million will be spent on dispersing clouds over Moscow for the May 1 holiday.
Researchers developed tiny, autonomous robots able to repair circuits.
The Scrip, a new universal cash device is bringing back the old metallic sparkle of the money and mixing it with today’s technology in order to fill the deficiencies of our credit and debit cards.
Being reminded by Facebook that it's your best friends' birthday.
To celebrate the 500 year anniversary for Hieronymus Bosch, Studio Smack made a contemporary interpretation of 'The Garden Of Earthly Delights'.
A proposal for a residential skyscraper in Tokyo Bay as part of “Next Tokyo”, takes into account the recurrent threats of rising sea levels, seismic activity and typhoons.
People with parkinson or other diseases that cause tremors or uncontrable muscular movements, eating is a major challenge. Liftware launches two smart spoons which corrects the unexpected movements of its eaters.
Nissan created the e-NV200 workspace: an electrical van with zero emissions that is packed with everything you need to work efficiently.
In their pursuit of mapping the physical world online, mapping services simultaneously shape our understanding of it too.
McDonald’s provided their Happy Meals with a high-tech activity tracker toy.
A Bricklaying Robot builds low-cost houses in just two days.
FarmBot Genesis is humanity's first open-source CNC farming machine designed for at-home automated food production.
We may be still far away from pollution-free Internet browsing, but at least the next time you send an e-mail you can feel relief at the thought that the strong arctic winds of Scandinavia are keeping the Google servers cool and running.
FysioPal is a smart top made to support and enhance the upper-body and posture.
This supermarket sells expired food to raise awareness over poverty, hunger and the environment.
The Bird Sounds experiment, powered by Google Creative lab, is a visualization of thousands of bird songs organized by their similarities.
This art installation turning coke into water raise questions on what, at the end of the day, should be considered 'the real thing'.
A Californian engineer is using old cellphones and solar panels to save the rainforest ecosystem against deforestation.
The experimental solar powered airplane Solar Impulse 2 succeeded its record-breaking journey over the Pacific. The Swiss team is now developing the next step of the project: solar drones.
Spiritual leader Deepak Chopra just unveiled a 20-minute therapy session inviting us to come back to the present moment through virtual reality.
Many companies are seeing the potential of this technology to solve food scarcity, reduce pollution and offer cruelty free meat. One of these firms is Tyson Foods, the meat giant.
A miniature piglet staring at you from a soup, to remind you the origins of your meal.
Web 0.0 is sa project by street-artist Biancoshock where web apps are contextualized in real life.
Jasper van Loenen developed a wearable that sends a corrective electrostatic shock to its wearer when visiting an unprotected website.
The concept of using our rooftops to produce green, renewable energy for our houses is already very common if we look at solar panels. Now an international team of scientists is …
In 1896 Dr Couney incubated premature babies. He saved at least 6.500 premature infants from death by putting them on display in Coney Island.
At the beginning of 2016, two artists made a 3D scan of the Nefertiti bust in the Neues Museum in Berlin and uploaded it to the Internet.
Take a look at this video to get an idea of what life with a virtual anime assistant would look like.
Hyundai envisions a future where your smart home is your driverless car, and vice versa.
Have you ever wondered what the infosphere looks like? Dutch designer Richard Vijgen’s app Architecture of Radio is a field guide to the hidden world of digital networks.
In year 400BCE in ancient Indian Sanskrit epics, 100 princes were created from a jar of ghee.
In the desert landscape of the Californian Coachella Valley, artist Jennifer Bolande installed a series of billboards that camouflage themselves with the surroundings.
Sanctifying servers with knowledge and power from digital demons.
How much carbon does a Youtube video burn? Greenpeace's #ClickClean initiative calls on big tech companies, like Google, to use renewable energy sources.
Using moss cultures, the "CityTree" captures and filters toxic pollutants from the air, with the same environmental impact of 275 trees.
In 1955 Emanuel M. Greenberg patented his Illustration of an artificial womb, his invention contains all the apparatus he thought would be required to grow a baby.
Eco Coin Award winner Dave Hakkens is upgrading his Precious Plastic recycling machines, and you can help him do it!
Meet Grovio, a smart and wireless assistant for your plants. Using specialized sensors, it automatically waters and monitors your plants in real time.
Norwegian researchers have succeeded to grow nori under laboratory conditions for the first time.
Games are often played to escape a boring daily reality, but they can also teach us to take control over the land as farmers do. As a farm director you work in a gamified …
In Icelandic national parks the use of drones has been forbidden. No camping, dogs to be kept on leashes, and please, leave your drones at home.
To all students! It's that time of the year again. We have six wonderful intern positions opening up in February 2018. Six! From editorial talent to design heroes to marketing …
Lego announced the next generation of building bricks, bringing the creations to life.
A ‘gold rush’ is haunting New Zealand’s beekeepers, as beehive and honey thefts are continuing to rise.
Ever stood in front of a mountain and wondered which other mountains you might like after seeing this one? No? Well, it's what we do everyday. London-based artist duo Scott Kelly …
GM varieties of petunia are not authorized for cultivation in the EU.
China recently built a panda shaped solar plant to get kids interested in green energy.
Pic2Recipe is an artificial intelligence system able to recognize ingredients, identify a dish and suggest recipes from a single image.
While this image seems like another polluted beach after spring break, it was taken on a remote uninhabited world heritage site in the Polynesia.
Help Dave Hakkens build the third version of his Precious Plastic recycling machines!
A new feature rumored to be in the next iOS update called Theater Mode could dim smartphone usage in cinemas.
Rent a rain room with simulated rain with a motion sensor to go through the rain without getting wet.
The multiplication of bacteria "paints" this lake with peculiar colours. Tints vary along magenta, green and yellow, giving it Rothko-like appearance.
Passenger-carrying drones will hit the skies in Dubai this summer.
The Pollution Pods installation replicates the smell and air quality of five different urban environments, forming the smell of a global economy.
The philosophy behind sponge cities is simple: cities should contribute to solving water related problems instead of causing them.
The story of money: an accessible roadmap from prehistory to digital age - from cows to credit, from gold mining to bitcoin mining.
Eco-friendly lasers might soon replace stick-on labels on fruits and veggies.
Meet the incredible new species "Petramosaurus Cavator" and discover its impact on our planet.
We are happy to announce our new upcoming weekly video-series on the 'Intimate Technology' theme.
Discover the cellular world with stick-on camera lenses for your smartphone.
Introducing nanobionic spinach plants that can detect explosives.
A virtual museum for poetry opens "its doors" at Museumplein in Amsterdam.
Discover the Next Nature Habitat VR and explore four future environments we might live in someday.
Discover the Next Nature Habitat VR and explore four future environments we might live in someday.
Discover the Next Nature Habitat VR and explore four future environments we might live in someday.
Introducing world's first voice mask designed to protect your privacy.
Today's peculiar image comes from New York's Met Museum. No, the woman depicted in the sculpture isn't holding a smartphone!
Researchers at the University of Technology in Delft have created flat structures able to fold themselves into three-dimensional constructions.
In the future, artificial wombs could replace incubators as they mimic the natural environment of the female uterus. But what will these devices look like?
Previously we predicted that we would be eating in vitro meat by 2028. But as it turns out... In vitro meat is already here! And we are not allowed to eat it. The meat has been …
Before social networks, there were episodic characters in our lives - people we've only met once or twice, and we haven’t heard from since. Nowadays whoever, we once add a person …
Submarines feature a special device called a periscope that allows people inside the submarine to see what's going on above water. Controlling such an eye requires hours of …
This question is an excerpt from the Pyramid of Technology toolkit Imagine asking your grandparents if they ‘have googled anything lately?’ Chances are they actually did, …
Meet the 'Eco-Visionaries' , these are the architects, artists and designers who respond to some of the most urgent ecological issues of our times. This exhibition reveals how …
Today is World Animal Day , a day to put the spotlight on man's best friends in order to improve their welfare standards around the globe. At Next Nature HQ, we honor this day by …
When perceiving the world around us as a potential Instagram post, some thoughts, stories and situations can easily be packed into a tweet or a photo, while others are harder to …
Now that the team of researchers at the Eindhoven University of Technology (whom we previously collaborated with to design a prototype for an artificial womb ) has been awarded a …
Berlin is kicking off its cultural season with the not-to-miss 23th installment of Transmediale . This year the digital art/culture festival focuses on how feelings are made into …
The spread of the coronavirus has led to the cancellation or postponement of many events around the globe. Luckily there are still events we can look forward to, such as the AI …
In anticipation of the forthcoming Next Nature Magazine, we call upon you, dearest creatives, to submit a fictitious editorial advertisement: The Infotizement. The infotizement is …
Hooray! This just in: Next Nature Network is granted a significant contribution from the Dutch government intended to develop a Future Lab for design & technology in Eindhoven …
Biosensors, cultivated meat and spider’s silk. For synthetic biologist and Next Nature ambassador Nadine Bongaerts, these are all advances towards a new world, where polluting …
Current social distancing measures are all about keeping a physical distance from each other in order to flatten the curve. But this does not mean we have to keep a distance from …
Loneliness is one of the silent serial killers during the pandemic. Therefore Next Nature provides you the tip to pick up your phone. Artists Danielle Baskin and Max Hawkin …
Data Dating is an exhibition that explores what it means to find romance in the internet age. Love it or hate it, technology has transformed the way we date. So, how are digital …
Good day astronauts of spaceship Earth! Today it was announced that Next Nature's plans for the Evoluon have been awarded a financial contribution of €7.6 million from the Region …
Travel to big future in our VR timemachine at the Evoluon in Eindhoven
What if women of childbearing age no longer had to interrupt their careers for a pregnancy? In Kuang-Yi Ku ’s project Grandmom Mom, we take a look into the future. In 2050, the …
Now here's a perspective: a pooping cow is like a living 3D printer
We need to talk about COVID-19. Again (or, still). One of the main questions about SARS-CoV-2, the virus that causes COVID-19, has for a while been about its origins. Most viruses …
Don’t get fooled by the colourful, unsuspecting demeanour and size of the mantis shrimp. Known as “death incarnate” to its prey on the seafloor, the crustacean hides two …
Did you know that we owe every second breath we take to the algae in the sea? And that minerals have been absorbing CO2 for billions of years while converting it into important …
Soon it will be possible to grow flowers with your phone. Niantic and Nintendo joined forces to create a new mobile game connected to the Pikmin franchise. In this augmented …
When we think of robots, we typically do not think of small cellular organisms made with embryonic cells from frogs. However, this is exactly what the joint teams at University of …
Memories are often considered very personal and private. Yet, in the past few years, people have got used to notifications from social media or phone galleries telling them they …
In a feat of biomimicry that seamlessly marries biology with physics, tests carried out at the University of Southern California’s Viterbi School of Engineering made fascinating …
In Next Nature: Why Technology Is Our Natural Future , Koert van Mensvoort takes us on an epic exploration through the wonderful world of culturally emerged nature. It offers a …
Will there still be a supermarket as we know it today in 2050?
What if we can use tattoos to measure the concentration of certain components in your blood? Scientists developed a film that can detect the amount of oxygen.
In the supermarket of the future, part of the Embassy of Food at Dutch Design Week, designer Merle Bergers will present her project Microbiota To Go.
*Our open call will continue for another month due to popular demand* Calling all art students, academics and everything in between. Are you a recent graduate (or soon to be)? Do …
Hello upcoming bio artists and designers! We invite designers and artists interested in bio art & design to propose projects for collaborative work across disciplines. The Bio …
The sun lies at the heart of our solar system, providing life-giving light, heat and energy to Earth. The sun always gives, without asking for anything in return. In the …
Danish fashion brand Ganni proposed a post-leather future: they grew imitation leather with bacteria.
Paco Rabanne already positioned himself as a cutting-edge designer by establishing his reputation as one of the trailblazers during the space age movement of the 1960s. With his …
Lo and behold the new Lotus Eletre Hyper SUV car. It shouldn't be allowed to exist, yet you may meet it in traffic soon.
This speculative kitchen device shows us a future where growing meat at home is not just a possibility but a reality.
Bye-bye gym membership, hello losing pounds. Scientists have found a new drug that helped obese mice lose weight.
What if we could control our dreams? In the near future, this might become a reality. Prophetic developed a new technology that enables lucid dream control.